Rroxscaffold_7G00172040

Cleavage site for pathogenic type III effector avirulence factor Avr

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0005965
Physical Location & Seq
Forward (+)
12351369 .. 12355551
4183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00172040.1

Sequence Viewer

Length: 210 bp
ATGCCAAAGTTCGGTGAATGGGCCGTCAGTGATCCAGCATCAGCAGAGGGATTCACAATAATCTTCAACAAGGCAAGCACTGAGGAAAAGACTGGTGACAGACCTGAGTCACCAGCAGAGGATGACTGCGCATATAAGCATGGAGCAGTTCTCGGAAAGCCTACCACTCTAGGTAAACAATGCAGGAGTACGTGGTTGGATGCATACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

69

Amino Acids

7.51

Weight (kDa)

4.94

Isoelectric Point (pI)

44.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 2 - 29 5.1e-13 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 130
AclWI GGATC 1 cut(s) 26
AfaI GTAC 1 cut(s) 190
AfiI CCNNNNNNNGG 1 cut(s) 11
AgsI TTSAA 1 cut(s) 67
AlwI GGATC 1 cut(s) 26
AoxI GGCC 1 cut(s) 21
AspLEI GCGC 1 cut(s) 131
AspS9I GGNCC 1 cut(s) 21
AsuHPI GGTGA 3 cut(s) 26, 102, 107
BceAI ACGGC 1 cut(s) 8
BfaI CTAG 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 21
BmsI GCATC 2 cut(s) 47, 190
BoxI GACNNNNGTC 1 cut(s) 106
BplI GAGNNNNNCTC 2 cut(s) 135, 167
BsaAI YACGTR 1 cut(s) 192
Bsc4I CCNNNNNNNGG 1 cut(s) 11
Bse1I ACTGG 1 cut(s) 97
BseGI GGATG 2 cut(s) 127, 205
BseLI CCNNNNNNNGG 1 cut(s) 11
BseMII CTCAG 2 cut(s) 72, 96
BseNI ACTGG 1 cut(s) 97
BshFI GGCC 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 11
BsnI GGCC 1 cut(s) 23
Bsp143I GATC 1 cut(s) 31
BspANI GGCC 1 cut(s) 23
BspCNI CTCAG 2 cut(s) 73, 97
BspPI GGATC 1 cut(s) 26
BsrI ACTGG 1 cut(s) 97
BssMI GATC 1 cut(s) 31
BstBAI YACGTR 1 cut(s) 192
BstC8I GCNNGC 1 cut(s) 76
BstDEI CTNAG 2 cut(s) 81, 105
BstF5I GGATG 2 cut(s) 127, 205
BstHHI GCGC 1 cut(s) 131
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstPAI GACNNNNGTC 1 cut(s) 106
BsuRI GGCC 1 cut(s) 23
BtsCI GGATG 2 cut(s) 127, 205
BtsIMutI CAGTG 2 cut(s) 34, 78
Cac8I GCNNGC 1 cut(s) 76
CfoI GCGC 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 21
Csp6I GTAC 1 cut(s) 189
CviAII CATG 1 cut(s) 140
CviJI RGCY 2 cut(s) 23, 160
CviKI_1 RGCY 2 cut(s) 23, 160
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 2 cut(s) 81, 105
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
EcoT22I ATGCAT 1 cut(s) 205
FaeI CATG 1 cut(s) 143
FaiI YATR 4 cut(s) 133, 135, 141, 205
FatI CATG 1 cut(s) 139
FokI GGATG 1 cut(s) 134
FspBI CTAG 1 cut(s) 170
FspI TGCGCA 1 cut(s) 130
GlaI GCGC 1 cut(s) 130
HaeIII GGCC 1 cut(s) 23
HhaI GCGC 1 cut(s) 131
Hin1II CATG 1 cut(s) 143
Hin6I GCGC 1 cut(s) 129
HinP1I GCGC 1 cut(s) 129
HinfI GANTC 2 cut(s) 51, 107
HphI GGTGA 3 cut(s) 26, 102, 107
Hpy166II GTNNAC 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 155
Hpy8I GTNNAC 1 cut(s) 176
HpyCH4IV ACGT 1 cut(s) 191
HpyCH4V TGCA 2 cut(s) 183, 203
HpyF3I CTNAG 2 cut(s) 81, 105
HpySE526I ACGT 1 cut(s) 191
Hsp92II CATG 1 cut(s) 143
HspAI GCGC 1 cut(s) 129
Kzo9I GATC 1 cut(s) 31
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 5 cut(s) 48, 78, 117, 126, 169
LweI GCATC 2 cut(s) 47, 190
MaeI CTAG 1 cut(s) 170
MaeII ACGT 1 cut(s) 191
MaeIII GTNAC 2 cut(s) 95, 108
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 1 cut(s) 55
MlyI GAGTC 1 cut(s) 116
MmeI TCCRAC 1 cut(s) 177
MnlI CCTC 3 cut(s) 40, 76, 112
Mph1103I ATGCAT 1 cut(s) 205
NdeII GATC 1 cut(s) 31
NlaIII CATG 1 cut(s) 143
NmuCI GTSAC 2 cut(s) 95, 108
NsbI TGCGCA 1 cut(s) 130
NsiI ATGCAT 1 cut(s) 205
PfeI GAWTC 1 cut(s) 51
PleI GAGTC 1 cut(s) 115
PpsI GAGTC 1 cut(s) 115
Ppu21I YACGTR 1 cut(s) 192
PshAI GACNNNNGTC 1 cut(s) 106
PspPI GGNCC 1 cut(s) 21
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
Sau3AI GATC 1 cut(s) 31
Sau96I GGNCC 1 cut(s) 21
SchI GAGTC 1 cut(s) 116
SetI ASST 3 cut(s) 106, 175, 194
SfaNI GCATC 2 cut(s) 47, 190
SspMI CTAG 1 cut(s) 170
TaiI ACGT 1 cut(s) 194
TfiI GAWTC 1 cut(s) 51
TscAI CASTG 2 cut(s) 34, 85
TseFI GTSAC 2 cut(s) 95, 108
Tsp45I GTSAC 2 cut(s) 95, 108
TspRI CASTG 2 cut(s) 34, 85
XspI CTAG 1 cut(s) 170
Zsp2I ATGCAT 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.