MD15G1247700.v1.1

RPM1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0005965
Physical Location & Seq
Forward (+)
20558881 .. 20559087
207 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1247700.v1.1.491

Sequence Viewer

Length: 207 bp
ATGGTGTACCGTTGCCAAAATTGGGATGTCAATGATCCAGCATCAGTTGAAGGATTCACTGTAATCTTCAACAAGGCTAGGACTGAGAAGAAGACGAGTGGTAGACCTGACTCACCACCAAAGGAGGACCACACATATAAGCAAGGAGTAGTTCTTGGAAAGCCTCCATCTAAAAAATGGTTTTGCTGCATGCGTGCGGAGTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

69

Amino Acids

7.78

Weight (kDa)

9.15

Isoelectric Point (pI)

41.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 7 - 31 5e-12 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 103
AciI CCGC 1 cut(s) 197
AclWI GGATC 1 cut(s) 29
AfaI GTAC 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 2 cut(s) 50, 70
AlwI GGATC 1 cut(s) 29
ApeKI GCWGC 1 cut(s) 186
AspS9I GGNCC 1 cut(s) 127
AsuHPI GGTGA 1 cut(s) 105
AvaII GGWCC 1 cut(s) 127
BbsI GAAGAC 1 cut(s) 98
BbvI GCAGC 1 cut(s) 173
BccI CCATC 1 cut(s) 175
BfaI CTAG 1 cut(s) 78
BisI GCNGC 1 cut(s) 187
BlsI GCNGC 1 cut(s) 188
Bme18I GGWCC 1 cut(s) 127
BmgT120I GGNCC 1 cut(s) 127
BmsI GCATC 1 cut(s) 50
BpiI GAAGAC 1 cut(s) 98
Bsc4I CCNNNNNNNGG 1 cut(s) 22
BseGI GGATG 1 cut(s) 31
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 75
BseXI GCAGC 1 cut(s) 173
BslI CCNNNNNNNGG 1 cut(s) 22
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 1 cut(s) 197
BspCNI CTCAG 1 cut(s) 76
BspHI TCATGA 1 cut(s) 203
BspPI GGATC 1 cut(s) 29
BssMI GATC 1 cut(s) 34
Bst4CI ACNGT 2 cut(s) 11, 61
BstC8I GCNNGC 2 cut(s) 191, 195
BstDEI CTNAG 1 cut(s) 84
BstF5I GGATG 1 cut(s) 31
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstNSI RCATGY 1 cut(s) 193
BstV1I GCAGC 1 cut(s) 173
BstV2I GAAGAC 1 cut(s) 98
BtsCI GGATG 1 cut(s) 31
BtsIMutI CAGTG 1 cut(s) 57
Cac8I GCNNGC 2 cut(s) 191, 195
CciI TCATGA 1 cut(s) 203
Cfr13I GGNCC 1 cut(s) 127
Csp6I GTAC 1 cut(s) 7
CviAII CATG 2 cut(s) 190, 204
CviJI RGCY 2 cut(s) 77, 163
CviKI_1 RGCY 2 cut(s) 77, 163
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 1 cut(s) 84
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco47I GGWCC 1 cut(s) 127
FaeI CATG 2 cut(s) 193, 207
FaiI YATR 4 cut(s) 136, 138, 191, 205
FatI CATG 2 cut(s) 189, 203
FblI GTMKAC 1 cut(s) 103
Fnu4HI GCNGC 1 cut(s) 187
FokI GGATG 1 cut(s) 38
Fsp4HI GCNGC 1 cut(s) 187
FspBI CTAG 1 cut(s) 78
GluI GCNGC 1 cut(s) 187
Hin1II CATG 2 cut(s) 193, 207
HinfI GANTC 3 cut(s) 54, 110, 200
HphI GGTGA 1 cut(s) 105
Hpy166II GTNNAC 2 cut(s) 7, 104
Hpy188III TCNNGA 1 cut(s) 204
Hpy8I GTNNAC 2 cut(s) 7, 104
HpyAV CCTTC 1 cut(s) 44
HpyCH4III ACNGT 2 cut(s) 11, 61
HpyCH4V TGCA 1 cut(s) 189
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 2 cut(s) 193, 207
Kzo9I GATC 1 cut(s) 34
LpnPI CCDG 2 cut(s) 51, 120
Lsp1109I GCAGC 1 cut(s) 173
LweI GCATC 1 cut(s) 50
MaeI CTAG 1 cut(s) 78
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 3 cut(s) 58, 100, 103
MluCI AATT 1 cut(s) 19
MlyI GAGTC 1 cut(s) 104
MnlI CCTC 2 cut(s) 118, 174
NdeII GATC 1 cut(s) 34
NlaIII CATG 2 cut(s) 193, 207
NspI RCATGY 1 cut(s) 193
PaeI GCATGC 1 cut(s) 193
PagI TCATGA 1 cut(s) 203
PfeI GAWTC 1 cut(s) 54
PkrI GCNGC 1 cut(s) 188
PleI GAGTC 1 cut(s) 104
PpsI GAGTC 1 cut(s) 104
PspPI GGNCC 1 cut(s) 127
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
SatI GCNGC 1 cut(s) 187
Sau3AI GATC 1 cut(s) 34
Sau96I GGNCC 1 cut(s) 127
SchI GAGTC 1 cut(s) 104
SetI ASST 1 cut(s) 109
SfaNI GCATC 1 cut(s) 50
SgeI CNNG 8 cut(s) 50, 85, 90, 108, 119, 155, 167, 202
SinI GGWCC 1 cut(s) 127
SphI GCATGC 1 cut(s) 193
Sse9I AATT 1 cut(s) 19
SsiI CCGC 1 cut(s) 197
SspMI CTAG 1 cut(s) 78
TaaI ACNGT 2 cut(s) 11, 61
TasI AATT 1 cut(s) 19
TfiI GAWTC 1 cut(s) 54
TscAI CASTG 1 cut(s) 64
TseI GCWGC 1 cut(s) 186
TspRI CASTG 1 cut(s) 64
VpaK11BI GGWCC 1 cut(s) 127
XceI RCATGY 1 cut(s) 193
XcmI CCANNNNNNNNNTGG 1 cut(s) 174
XmiI GTMKAC 1 cut(s) 103
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.