RchiOBHm_Chr6g0295941

Cleavage site for pathogenic type III effector avirulence factor Avr

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0005965
Physical Location & Seq
Reverse (-)
57785588 .. 57785743
156 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26561

Sequence Viewer

Length: 156 bp
ATGCCAAAGTTCGGTGAATGGGACGTCAGTGATCCAGCATCAGCAGAGGGATTCACAGTAATCTTCAACAAGGCAAGGACTGAGGAAAAGACTGGTGGCAGACCTGAGTCACCAGCAGAGGATGACTGCACATATAAGCATGGAGCAGTTCTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

51

Amino Acids

5.57

Weight (kDa)

4.68

Isoelectric Point (pI)

63.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 2 - 29 1.1e-16 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 27
AclWI GGATC 1 cut(s) 26
AcyI GRCGYC 1 cut(s) 24
AfiI CCNNNNNNNGG 1 cut(s) 11
AgsI TTSAA 1 cut(s) 67
AlwI GGATC 1 cut(s) 26
AsuHPI GGTGA 2 cut(s) 26, 102
BmsI GCATC 1 cut(s) 47
BoxI GACNNNNGTC 1 cut(s) 106
BplI GAGNNNNNCTC 1 cut(s) 135
BsaHI GRCGYC 1 cut(s) 24
Bsc4I CCNNNNNNNGG 1 cut(s) 11
Bse1I ACTGG 1 cut(s) 97
BseGI GGATG 1 cut(s) 127
BseLI CCNNNNNNNGG 1 cut(s) 11
BseMII CTCAG 2 cut(s) 72, 96
BseNI ACTGG 1 cut(s) 97
BsgI GTGCAG 1 cut(s) 112
BslFI GGGAC 1 cut(s) 35
BslI CCNNNNNNNGG 1 cut(s) 11
BsmFI GGGAC 1 cut(s) 35
Bsp143I GATC 1 cut(s) 31
BspCNI CTCAG 2 cut(s) 73, 97
BspPI GGATC 1 cut(s) 26
BsrI ACTGG 1 cut(s) 97
BssMI GATC 1 cut(s) 31
BssNI GRCGYC 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 58
BstACI GRCGYC 1 cut(s) 24
BstDEI CTNAG 2 cut(s) 81, 105
BstF5I GGATG 1 cut(s) 127
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstPAI GACNNNNGTC 1 cut(s) 106
BtsCI GGATG 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 34
CviAII CATG 1 cut(s) 140
DdeI CTNAG 2 cut(s) 81, 105
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
FaeI CATG 1 cut(s) 143
FaiI YATR 3 cut(s) 133, 135, 141
FaqI GGGAC 1 cut(s) 35
FatI CATG 1 cut(s) 139
FokI GGATG 1 cut(s) 134
Hin1I GRCGYC 1 cut(s) 24
Hin1II CATG 1 cut(s) 143
HinfI GANTC 2 cut(s) 51, 107
HphI GGTGA 2 cut(s) 26, 102
Hpy188I TCNGA 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4IV ACGT 1 cut(s) 24
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 2 cut(s) 81, 105
HpySE526I ACGT 1 cut(s) 24
Hsp92I GRCGYC 1 cut(s) 24
Hsp92II CATG 1 cut(s) 143
Kzo9I GATC 1 cut(s) 31
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 4 cut(s) 48, 78, 117, 126
LweI GCATC 1 cut(s) 47
MaeII ACGT 1 cut(s) 24
MaeIII GTNAC 1 cut(s) 108
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 1 cut(s) 55
MlyI GAGTC 1 cut(s) 116
MnlI CCTC 3 cut(s) 40, 76, 112
NdeII GATC 1 cut(s) 31
NlaIII CATG 1 cut(s) 143
NmuCI GTSAC 1 cut(s) 108
PfeI GAWTC 1 cut(s) 51
PleI GAGTC 1 cut(s) 115
PpsI GAGTC 1 cut(s) 115
PshAI GACNNNNGTC 1 cut(s) 106
Sau3AI GATC 1 cut(s) 31
SchI GAGTC 1 cut(s) 116
SetI ASST 2 cut(s) 27, 106
SfaNI GCATC 1 cut(s) 47
SgeI CNNG 7 cut(s) 47, 82, 87, 105, 116, 125, 152
TaaI ACNGT 1 cut(s) 58
TaiI ACGT 1 cut(s) 27
TfiI GAWTC 1 cut(s) 51
TscAI CASTG 1 cut(s) 34
TseFI GTSAC 1 cut(s) 108
Tsp45I GTSAC 1 cut(s) 108
TspRI CASTG 1 cut(s) 34
ZraI GACGTC 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.