MD15G1337200.v1.1

RPM1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0005965
Physical Location & Seq
Reverse (-)
37909807 .. 37911128
1322 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1337200.v1.1.491

Sequence Viewer

Length: 237 bp
ATGATTGATTCCCTTAATCAAAATTATGTAAATCCACAGGAAAAGGGTGTACCGTTGCCAAAATTTGGTGAATGGGATGTCAATGATCCAGTATCAGCTGAGGGATTCACTGTAATCTTCAACAAGGCTAGGATTGAGAAGAAGACAGGTGGCAGACCTGACTCACCATCAAAGCAGGATCGCACATATAATCATGAAGCAATTCTCAGAAAGCCTCAATCTGGTATCAGAAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

79

Amino Acids

8.87

Weight (kDa)

9.45

Isoelectric Point (pI)

63.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 14 - 48 1.4e-18 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 65
AclWI GGATC 2 cut(s) 80, 186
AcsI RAATTY 1 cut(s) 62
AfaI GTAC 1 cut(s) 51
AfiI CCNNNNNNNGG 2 cut(s) 65, 221
AgsI TTSAA 1 cut(s) 121
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
AlwI GGATC 2 cut(s) 80, 186
ApoI RAATTY 1 cut(s) 62
Asp700I GAANNNNTTC 1 cut(s) 201
AsuHPI GGTGA 2 cut(s) 80, 156
BbsI GAAGAC 1 cut(s) 149
BbvCI CCTCAGC 1 cut(s) 99
BccI CCATC 1 cut(s) 175
BfaI CTAG 1 cut(s) 129
BpiI GAAGAC 1 cut(s) 149
Bpu10I CCTNAGC 1 cut(s) 99
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 221
Bse1I ACTGG 1 cut(s) 89
BseGI GGATG 1 cut(s) 82
BseLI CCNNNNNNNGG 2 cut(s) 65, 221
BseMII CTCAG 2 cut(s) 90, 220
BseNI ACTGG 1 cut(s) 89
BslI CCNNNNNNNGG 2 cut(s) 65, 221
Bsp143I GATC 2 cut(s) 85, 178
BspCNI CTCAG 2 cut(s) 91, 219
BspHI TCATGA 1 cut(s) 193
BspPI GGATC 2 cut(s) 80, 186
BsrI ACTGG 1 cut(s) 89
BssMI GATC 2 cut(s) 85, 178
Bst4CI ACNGT 2 cut(s) 54, 112
BstDEI CTNAG 2 cut(s) 99, 206
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 2 cut(s) 88, 181
BstMBI GATC 2 cut(s) 85, 178
BstV2I GAAGAC 1 cut(s) 149
BtsCI GGATG 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 108
CciI TCATGA 1 cut(s) 193
Csp6I GTAC 1 cut(s) 50
CviAII CATG 1 cut(s) 194
CviJI RGCY 3 cut(s) 98, 128, 214
CviKI_1 RGCY 3 cut(s) 98, 128, 214
CviQI GTAC 1 cut(s) 50
DdeI CTNAG 2 cut(s) 99, 206
DpnI GATC 2 cut(s) 87, 180
DpnII GATC 2 cut(s) 85, 178
FaeI CATG 1 cut(s) 197
FaiI YATR 4 cut(s) 27, 187, 189, 195
FatI CATG 1 cut(s) 193
FokI GGATG 1 cut(s) 89
FspBI CTAG 1 cut(s) 129
Hin1II CATG 1 cut(s) 197
HinfI GANTC 3 cut(s) 8, 105, 161
HphI GGTGA 2 cut(s) 80, 156
Hpy166II GTNNAC 1 cut(s) 50
Hpy188I TCNGA 2 cut(s) 209, 230
Hpy188III TCNNGA 1 cut(s) 194
Hpy8I GTNNAC 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 225
HpyCH4III ACNGT 2 cut(s) 54, 112
HpyF3I CTNAG 2 cut(s) 99, 206
Hsp92II CATG 1 cut(s) 197
Kzo9I GATC 2 cut(s) 85, 178
LpnPI CCDG 6 cut(s) 23, 102, 132, 161, 171, 207
MaeI CTAG 1 cut(s) 129
MalI GATC 2 cut(s) 87, 180
MboI GATC 2 cut(s) 85, 178
MboII GAAGA 3 cut(s) 109, 151, 154
MluCI AATT 3 cut(s) 22, 62, 201
MlyI GAGTC 1 cut(s) 155
MnlI CCTC 2 cut(s) 94, 225
MroXI GAANNNNTTC 1 cut(s) 201
MseI TTAA 1 cut(s) 15
MspA1I CMGCKG 1 cut(s) 98
NdeII GATC 2 cut(s) 85, 178
NlaIII CATG 1 cut(s) 197
PagI TCATGA 1 cut(s) 193
PdmI GAANNNNTTC 1 cut(s) 201
PfeI GAWTC 2 cut(s) 8, 105
PflMI CCANNNNNTGG 1 cut(s) 65
PleI GAGTC 1 cut(s) 155
PpsI GAGTC 1 cut(s) 155
PvuII CAGCTG 1 cut(s) 98
RsaI GTAC 1 cut(s) 51
RsaNI GTAC 1 cut(s) 50
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 2 cut(s) 85, 178
SchI GAGTC 1 cut(s) 155
SetI ASST 4 cut(s) 100, 151, 160, 236
SgeI CNNG 8 cut(s) 50, 101, 136, 141, 159, 170, 188, 206
Sse9I AATT 3 cut(s) 22, 62, 201
SspMI CTAG 1 cut(s) 129
TaaI ACNGT 2 cut(s) 54, 112
TasI AATT 3 cut(s) 22, 62, 201
TfiI GAWTC 2 cut(s) 8, 105
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TscAI CASTG 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 210
TspRI CASTG 1 cut(s) 115
Van91I CCANNNNNTGG 1 cut(s) 65
XapI RAATTY 1 cut(s) 62
XmnI GAANNNNTTC 1 cut(s) 201
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.