MD09G1128500.v1.1

RPM1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0005965
Physical Location & Seq
Forward (+)
9939102 .. 9941701
2600 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1128500.v1.1.491

Sequence Viewer

Length: 225 bp
ATGGGGGAAAAGGGTGTACCGCTGCCAAAATTTGGTGAATGGGATGTCAATGATCCAGCATCAGCTGAGGGATTCACTGTAATCTTCAACAAGGCTAGGACTGAGAAGCAGACAGGTGGTAGACCTGACTCACCATCAAAGGAGGACCACGCATATAAGCAAGGAGCAGTTCTTGGAAAGCCTCCATCTAAAAAATGGTTTTGCTGCTTGCGTTCGGAGTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

75

Amino Acids

8.13

Weight (kDa)

8.64

Isoelectric Point (pI)

58.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 3 - 37 2.8e-20 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 32
AccI GTMKAC 1 cut(s) 121
AciI CCGC 1 cut(s) 20
AclWI GGATC 1 cut(s) 47
AcsI RAATTY 1 cut(s) 29
AfaI GTAC 1 cut(s) 18
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 1 cut(s) 88
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
AlwI GGATC 1 cut(s) 47
ApeKI GCWGC 2 cut(s) 22, 204
ApoI RAATTY 1 cut(s) 29
AspS9I GGNCC 1 cut(s) 145
AsuHPI GGTGA 2 cut(s) 47, 123
AvaII GGWCC 1 cut(s) 145
BbvCI CCTCAGC 1 cut(s) 66
BbvI GCAGC 2 cut(s) 9, 191
BccI CCATC 2 cut(s) 142, 193
BfaI CTAG 1 cut(s) 96
BisI GCNGC 2 cut(s) 23, 205
BlsI GCNGC 2 cut(s) 24, 206
Bme18I GGWCC 1 cut(s) 145
BmgT120I GGNCC 1 cut(s) 145
BmsI GCATC 1 cut(s) 68
Bpu10I CCTNAGC 1 cut(s) 66
Bsc4I CCNNNNNNNGG 1 cut(s) 32
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMII CTCAG 2 cut(s) 57, 93
BseXI GCAGC 2 cut(s) 9, 191
BslI CCNNNNNNNGG 1 cut(s) 32
Bsp143I GATC 1 cut(s) 52
BspACI CCGC 1 cut(s) 20
BspCNI CTCAG 2 cut(s) 58, 94
BspHI TCATGA 1 cut(s) 221
BspPI GGATC 1 cut(s) 47
BssMI GATC 1 cut(s) 52
Bst4CI ACNGT 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 209
BstDEI CTNAG 2 cut(s) 66, 102
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 1 cut(s) 55
BstMBI GATC 1 cut(s) 52
BstV1I GCAGC 2 cut(s) 9, 191
BtsCI GGATG 1 cut(s) 49
BtsIMutI CAGTG 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 209
CciI TCATGA 1 cut(s) 221
Cfr13I GGNCC 1 cut(s) 145
Csp6I GTAC 1 cut(s) 17
CviAII CATG 1 cut(s) 222
CviJI RGCY 3 cut(s) 65, 95, 181
CviKI_1 RGCY 3 cut(s) 65, 95, 181
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 2 cut(s) 66, 102
DpnI GATC 1 cut(s) 54
DpnII GATC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 145
FaeI CATG 1 cut(s) 225
FaiI YATR 3 cut(s) 154, 156, 223
FatI CATG 1 cut(s) 221
FblI GTMKAC 1 cut(s) 121
Fnu4HI GCNGC 2 cut(s) 23, 205
FokI GGATG 1 cut(s) 56
Fsp4HI GCNGC 2 cut(s) 23, 205
FspBI CTAG 1 cut(s) 96
GluI GCNGC 2 cut(s) 23, 205
Hin1II CATG 1 cut(s) 225
HinfI GANTC 3 cut(s) 72, 128, 218
HphI GGTGA 2 cut(s) 47, 123
Hpy166II GTNNAC 2 cut(s) 17, 122
Hpy188I TCNGA 1 cut(s) 217
Hpy188III TCNNGA 1 cut(s) 222
Hpy8I GTNNAC 2 cut(s) 17, 122
HpyCH4III ACNGT 1 cut(s) 79
HpyF3I CTNAG 2 cut(s) 66, 102
Hsp92II CATG 1 cut(s) 225
Kzo9I GATC 1 cut(s) 52
LmnI GCTCC 1 cut(s) 164
LpnPI CCDG 3 cut(s) 69, 99, 138
Lsp1109I GCAGC 2 cut(s) 9, 191
LweI GCATC 1 cut(s) 68
MaeI CTAG 1 cut(s) 96
MalI GATC 1 cut(s) 54
MboI GATC 1 cut(s) 52
MboII GAAGA 1 cut(s) 76
MluCI AATT 1 cut(s) 29
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 3 cut(s) 61, 136, 192
MspA1I CMGCKG 2 cut(s) 22, 65
NdeII GATC 1 cut(s) 52
NlaIII CATG 1 cut(s) 225
PagI TCATGA 1 cut(s) 221
PfeI GAWTC 1 cut(s) 72
PflMI CCANNNNNTGG 1 cut(s) 32
PkrI GCNGC 2 cut(s) 24, 206
PleI GAGTC 1 cut(s) 122
PpsI GAGTC 1 cut(s) 122
PspPI GGNCC 1 cut(s) 145
PvuII CAGCTG 1 cut(s) 65
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
SatI GCNGC 2 cut(s) 23, 205
Sau3AI GATC 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 145
SchI GAGTC 1 cut(s) 122
SetI ASST 3 cut(s) 67, 118, 127
SfaNI GCATC 1 cut(s) 68
SgeI CNNG 9 cut(s) 68, 103, 108, 126, 137, 161, 173, 185, 220
SinI GGWCC 1 cut(s) 145
Sse9I AATT 1 cut(s) 29
SsiI CCGC 1 cut(s) 20
SspMI CTAG 1 cut(s) 96
TaaI ACNGT 1 cut(s) 79
TasI AATT 1 cut(s) 29
TfiI GAWTC 1 cut(s) 72
TscAI CASTG 1 cut(s) 82
TseI GCWGC 2 cut(s) 22, 204
TspRI CASTG 1 cut(s) 82
Van91I CCANNNNNTGG 1 cut(s) 32
VpaK11BI GGWCC 1 cut(s) 145
XapI RAATTY 1 cut(s) 29
XcmI CCANNNNNNNNNTGG 1 cut(s) 192
XmiI GTMKAC 1 cut(s) 121
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.