AT2G18740

Small nuclear ribonucleoprotein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
OG0006603
Physical Location & Seq
Forward (+)
8123195 .. 8125078
1884 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G18740.1

Sequence Viewer

Length: 267 bp
ATGGCGAGCACCAAAGTTCAAAGGATTATGACCCAACCTATCAACTTGATTTTTAGGTTTCTTCAAAGTAAAGCTAGGATCCAGATTTGGCTATTTGAGCAGAAAGATTTGAGGATTGAAGGAAGAATCACTGGTTTTGACGAATACATGAATCTAGTTTTGGATGAGGCTGAAGAAGTGAGCATCAAGAAGAACACCAGGAAACCACTTGGAAGGATTTTACTCAAAGGAGACAACATAACTCTGATGATGAACACGGGAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 map03040
Pfam Domains
Protein Families
LSM

Protein Analysis

88

Amino Acids

10.3

Weight (kDa)

9.89

Isoelectric Point (pI)

39.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LSM PF01423 19 - 84 3e-18 LSM domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 73, 86
AcuI CTGAAG 1 cut(s) 192
AgsI TTSAA 3 cut(s) 20, 65, 119
AjnI CCWGG 1 cut(s) 197
AjuI GAANNNNNNNTTGG 2 cut(s) 143, 175
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 11
Alw26I GTCTC 1 cut(s) 225
AlwI GGATC 2 cut(s) 73, 86
BamHI GGATCC 1 cut(s) 78
Bbv12I GWGCWC 1 cut(s) 11
BciT130I CCWGG 1 cut(s) 199
BcoDI GTCTC 1 cut(s) 225
BfaI CTAG 2 cut(s) 75, 155
Bme1390I CCNGG 1 cut(s) 199
BmiI GGNNCC 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 199
BmsI GCATC 1 cut(s) 192
Bse1I ACTGG 1 cut(s) 136
BseBI CCWGG 1 cut(s) 199
BseGI GGATG 1 cut(s) 169
BseNI ACTGG 1 cut(s) 136
BsiHKAI GWGCWC 1 cut(s) 11
BsmAI GTCTC 1 cut(s) 225
Bsp1286I GDGCHC 1 cut(s) 11
Bsp143I GATC 1 cut(s) 78
BspLI GGNNCC 1 cut(s) 80
BspPI GGATC 2 cut(s) 73, 86
BsrI ACTGG 1 cut(s) 136
BssMI GATC 1 cut(s) 78
Bst2UI CCWGG 1 cut(s) 199
BstC8I GCNNGC 1 cut(s) 7
BstF5I GGATG 1 cut(s) 169
BstKTI GATC 1 cut(s) 81
BstMAI GTCTC 1 cut(s) 225
BstMBI GATC 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstNI CCWGG 1 cut(s) 199
BstSCI CCNGG 1 cut(s) 197
BstX2I RGATCY 1 cut(s) 78
BstYI RGATCY 1 cut(s) 78
BtsCI GGATG 1 cut(s) 169
BtsIMutI CAGTG 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 7
CviAII CATG 1 cut(s) 148
CviJI RGCY 3 cut(s) 74, 91, 170
CviKI_1 RGCY 3 cut(s) 74, 91, 170
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
Eco57I CTGAAG 1 cut(s) 192
EcoRII CCWGG 1 cut(s) 197
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 29, 149, 239
FatI CATG 1 cut(s) 147
FokI GGATG 1 cut(s) 176
FspBI CTAG 2 cut(s) 75, 155
Hin1II CATG 1 cut(s) 151
HinfI GANTC 2 cut(s) 126, 151
Hpy188I TCNGA 1 cut(s) 246
Hpy188III TCNNGA 2 cut(s) 82, 187
HpyAV CCTTC 2 cut(s) 113, 207
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
Hsp92II CATG 1 cut(s) 151
Kzo9I GATC 1 cut(s) 78
LpnPI CCDG 4 cut(s) 95, 117, 184, 211
LweI GCATC 1 cut(s) 192
MaeI CTAG 2 cut(s) 75, 155
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 4 cut(s) 53, 135, 185, 202
MflI RGATCY 1 cut(s) 78
MhlI GDGCHC 1 cut(s) 11
MnlI CCTC 2 cut(s) 105, 160
MspR9I CCNGG 1 cut(s) 199
MvaI CCWGG 1 cut(s) 199
MwoI GCNNNNNNNGC 1 cut(s) 97
NdeII GATC 1 cut(s) 78
NlaIII CATG 1 cut(s) 151
NlaIV GGNNCC 1 cut(s) 80
PfeI GAWTC 2 cut(s) 126, 151
Psp6I CCWGG 1 cut(s) 197
PspGI CCWGG 1 cut(s) 197
PspN4I GGNNCC 1 cut(s) 80
PsuI RGATCY 1 cut(s) 78
Sau3AI GATC 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 199
SduI GDGCHC 1 cut(s) 11
SetI ASST 3 cut(s) 40, 59, 76
SfaNI GCATC 1 cut(s) 192
SspMI CTAG 2 cut(s) 75, 155
StyD4I CCNGG 1 cut(s) 197
TfiI GAWTC 2 cut(s) 126, 151
TscAI CASTG 1 cut(s) 136
TspDTI ATGAA 2 cut(s) 164, 266
TspRI CASTG 1 cut(s) 136
XspI CTAG 2 cut(s) 75, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.