Prupe.4G278600_v2.0.a1

Small nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
23460926 .. 23464251
3326 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G278600.1

Sequence Viewer

Length: 267 bp
ATGGCGAGCACCAAAGTTCAGAGGATTATGACCCAACCCATTAACTTGATTTTCAGGTTCCTTCAAAGTAAAGCTCGCATTCAGATATGGCTCTTTGAGCAGAAGGACCTCAGGATTGAAGGCCGAATTATTGGTTTTGATGAGTATATGAATTTGGTTCTGGATGAGGCCGAAGAAGTTAGCATCAAGAAAAAAACCAGAAAGTCATTGGGACGCATTCTTCTGAAAGGAGATAACATAACTCTGATGATGAACACGGGGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.31

Weight (kDa)

9.99

Isoelectric Point (pI)

41.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 151
AgsI TTSAA 2 cut(s) 65, 119
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 11
AoxI GGCC 2 cut(s) 121, 168
ApoI RAATTY 1 cut(s) 151
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
AxyI CCTNAGG 1 cut(s) 110
Bbv12I GWGCWC 1 cut(s) 11
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 59
BmsI GCATC 1 cut(s) 192
Bse21I CCTNAGG 1 cut(s) 110
BseGI GGATG 1 cut(s) 169
BseMII CTCAG 1 cut(s) 124
BshFI GGCC 2 cut(s) 123, 170
BsiHKAI GWGCWC 1 cut(s) 11
BslFI GGGAC 1 cut(s) 225
BsmFI GGGAC 1 cut(s) 225
BsmI GAATGC 2 cut(s) 78, 216
BsnI GGCC 2 cut(s) 123, 170
Bsp1286I GDGCHC 1 cut(s) 11
BspANI GGCC 2 cut(s) 123, 170
BspCNI CTCAG 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 59
BstC8I GCNNGC 2 cut(s) 7, 76
BstDEI CTNAG 1 cut(s) 110
BstF5I GGATG 1 cut(s) 169
BstMWI GCNNNNNNNGC 1 cut(s) 97
Bsu36I CCTNAGG 1 cut(s) 110
BsuRI GGCC 2 cut(s) 123, 170
BtsCI GGATG 1 cut(s) 169
Cac8I GCNNGC 2 cut(s) 7, 76
Cfr13I GGNCC 1 cut(s) 106
CseI GACGC 1 cut(s) 222
CviJI RGCY 4 cut(s) 74, 91, 123, 170
CviKI_1 RGCY 4 cut(s) 74, 91, 123, 170
DdeI CTNAG 1 cut(s) 110
Eco47I GGWCC 1 cut(s) 106
Eco81I CCTNAGG 1 cut(s) 110
EcoO109I RGGNCCY 1 cut(s) 106
FaiI YATR 5 cut(s) 29, 88, 147, 149, 239
FaqI GGGAC 1 cut(s) 225
FokI GGATG 1 cut(s) 176
HaeIII GGCC 2 cut(s) 123, 170
HgaI GACGC 1 cut(s) 222
Hpy188I TCNGA 4 cut(s) 21, 84, 225, 246
Hpy188III TCNNGA 3 cut(s) 112, 161, 187
HpyAV CCTTC 3 cut(s) 71, 97, 113
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpyF3I CTNAG 1 cut(s) 110
LpnPI CCDG 4 cut(s) 40, 97, 146, 211
LweI GCATC 1 cut(s) 192
MboII GAAGA 2 cut(s) 185, 212
MhlI GDGCHC 1 cut(s) 11
MluCI AATT 2 cut(s) 126, 151
MnlI CCTC 3 cut(s) 15, 119, 160
MseI TTAA 1 cut(s) 42
Mva1269I GAATGC 2 cut(s) 78, 216
MwoI GCNNNNNNNGC 1 cut(s) 97
NlaIV GGNNCC 1 cut(s) 59
PctI GAATGC 2 cut(s) 78, 216
PpuMI RGGWCCY 1 cut(s) 106
Psp5II RGGWCCY 1 cut(s) 106
PspN4I GGNNCC 1 cut(s) 59
PspPI GGNCC 1 cut(s) 106
PspPPI RGGWCCY 1 cut(s) 106
SaqAI TTAA 1 cut(s) 42
Sau96I GGNCC 1 cut(s) 106
SduI GDGCHC 1 cut(s) 11
SetI ASST 3 cut(s) 59, 76, 111
SfaNI GCATC 1 cut(s) 192
SgeI CNNG 8 cut(s) 18, 58, 67, 87, 124, 173, 199, 210
SinI GGWCC 1 cut(s) 106
Sse9I AATT 2 cut(s) 126, 151
TasI AATT 2 cut(s) 126, 151
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TspDTI ATGAA 2 cut(s) 164, 266
VpaK11BI GGWCC 1 cut(s) 106
XapI RAATTY 1 cut(s) 151
XcmI CCANNNNNNNNNTGG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.