Rh1AG040500

Small nuclear ribonucleoprotein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0006603
Physical Location & Seq
Forward (+)
7158743 .. 7161341
2599 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG040500.1

Sequence Viewer

Length: 267 bp
ATGGCGAGCACCAAAGTTCAGAGGATCATGACCCAGCCCATTAACTTGATTTTCAGGTTCCTCCAGAGTAAAGCTCGAATTCAGATTTGGCTCTTTGAACAGAAAGACGTCAGGATTGAAGGCCGAATCATTGGTTTTGATGAGTACATGAATTTGGTTCTAGATGATGCTGAAGAAGTGAGCATCAAGAAGAATACCAGAAAGACACTAGGAAGGATTCTTCTTAAAGGAGATAACATAACTCTCATGATGAACACGGGGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 map03040
Pfam Domains
Protein Families
LSM

Protein Analysis

88

Amino Acids

10.29

Weight (kDa)

9.89

Isoelectric Point (pI)

38.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LSM PF01423 19 - 84 1.8e-18 LSM domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 111
AclWI GGATC 1 cut(s) 32
AcsI RAATTY 2 cut(s) 78, 151
AcuI CTGAAG 1 cut(s) 192
AcyI GRCGYC 1 cut(s) 108
AfaI GTAC 1 cut(s) 146
AgsI TTSAA 2 cut(s) 98, 119
AjuI GAANNNNNNNTTGG 2 cut(s) 70, 102
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 11
AlwI GGATC 1 cut(s) 32
AoxI GGCC 1 cut(s) 121
ApoI RAATTY 2 cut(s) 78, 151
Bbv12I GWGCWC 1 cut(s) 11
BfaI CTAG 2 cut(s) 161, 209
BmiI GGNNCC 1 cut(s) 59
BmsI GCATC 2 cut(s) 157, 192
BplI GAGNNNNNCTC 2 cut(s) 58, 90
BpmI CTGGAG 1 cut(s) 47
BsaHI GRCGYC 1 cut(s) 108
BseYI CCCAGC 1 cut(s) 33
BshFI GGCC 1 cut(s) 123
BsiHKAI GWGCWC 1 cut(s) 11
BsnI GGCC 1 cut(s) 123
Bsp1286I GDGCHC 1 cut(s) 11
Bsp143I GATC 1 cut(s) 24
BspANI GGCC 1 cut(s) 123
BspHI TCATGA 2 cut(s) 27, 246
BspLI GGNNCC 1 cut(s) 59
BspPI GGATC 1 cut(s) 32
BssMI GATC 1 cut(s) 24
BssNI GRCGYC 1 cut(s) 108
BstACI GRCGYC 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 7
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BsuRI GGCC 1 cut(s) 123
Cac8I GCNNGC 1 cut(s) 7
CciI TCATGA 2 cut(s) 27, 246
Csp6I GTAC 1 cut(s) 145
CviAII CATG 3 cut(s) 28, 148, 247
CviJI RGCY 4 cut(s) 37, 74, 91, 123
CviKI_1 RGCY 4 cut(s) 37, 74, 91, 123
CviQI GTAC 1 cut(s) 145
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 192
EcoRI GAATTC 1 cut(s) 78
FaeI CATG 3 cut(s) 31, 151, 250
FaiI YATR 4 cut(s) 29, 149, 239, 248
FatI CATG 3 cut(s) 27, 147, 246
FspBI CTAG 2 cut(s) 161, 209
GsaI CCCAGC 1 cut(s) 37
GsuI CTGGAG 1 cut(s) 47
HaeIII GGCC 1 cut(s) 123
Hin1I GRCGYC 1 cut(s) 108
Hin1II CATG 3 cut(s) 31, 151, 250
HinfI GANTC 2 cut(s) 126, 217
Hpy188I TCNGA 2 cut(s) 21, 84
Hpy188III TCNNGA 6 cut(s) 28, 64, 112, 161, 187, 247
HpyAV CCTTC 2 cut(s) 113, 207
HpyCH4IV ACGT 1 cut(s) 108
HpySE526I ACGT 1 cut(s) 108
Hsp92I GRCGYC 1 cut(s) 108
Hsp92II CATG 3 cut(s) 31, 151, 250
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 5 cut(s) 40, 47, 77, 97, 211
LweI GCATC 2 cut(s) 157, 192
MaeI CTAG 2 cut(s) 161, 209
MaeII ACGT 1 cut(s) 108
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 3 cut(s) 185, 202, 212
MhlI GDGCHC 1 cut(s) 11
MluCI AATT 2 cut(s) 78, 151
MnlI CCTC 2 cut(s) 15, 71
MseI TTAA 2 cut(s) 42, 225
NdeII GATC 1 cut(s) 24
NlaIII CATG 3 cut(s) 31, 151, 250
NlaIV GGNNCC 1 cut(s) 59
PagI TCATGA 2 cut(s) 27, 246
PfeI GAWTC 2 cut(s) 126, 217
PspFI CCCAGC 1 cut(s) 33
PspN4I GGNNCC 1 cut(s) 59
RsaI GTAC 1 cut(s) 146
RsaNI GTAC 1 cut(s) 145
SaqAI TTAA 2 cut(s) 42, 225
Sau3AI GATC 1 cut(s) 24
SduI GDGCHC 1 cut(s) 11
SetI ASST 3 cut(s) 59, 76, 111
SfaNI GCATC 2 cut(s) 157, 192
Sse9I AATT 2 cut(s) 78, 151
SspMI CTAG 2 cut(s) 161, 209
TaiI ACGT 1 cut(s) 111
TaqI TCGA 1 cut(s) 76
TasI AATT 2 cut(s) 78, 151
TatI WGTACW 1 cut(s) 144
TfiI GAWTC 2 cut(s) 126, 217
Tru1I TTAA 2 cut(s) 42, 225
Tru9I TTAA 2 cut(s) 42, 225
TspDTI ATGAA 2 cut(s) 164, 266
XapI RAATTY 2 cut(s) 78, 151
XbaI TCTAGA 1 cut(s) 160
XspI CTAG 2 cut(s) 161, 209
ZraI GACGTC 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.