AT2G34120

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
14405339 .. 14405551
213 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G34120.1

Sequence Viewer

Length: 213 bp
ATGAATAGCTTGACATTGAAAAGTGAGGAAGCAACAATTACAAAGACGCCAAGGGATTATTTGAAGGCGAAATCGCCAAAGAGAAGCGTGAACTATCTAGTAGCACACGCCGGAGAGGATGAATCGATTGAGAGACAAGAAAATGAAGACGACGACGGAAGAGCAAGTGTTGAGGACGACGACGAAGAGGACGAATTAATGTCGTCCGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.91

Weight (kDa)

4.27

Isoelectric Point (pI)

67.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011762)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 47
AgsI TTSAA 2 cut(s) 19, 64
AluBI AGCT 1 cut(s) 9
AluI AGCT 1 cut(s) 9
Alw26I GTCTC 1 cut(s) 127
AseI ATTAAT 1 cut(s) 197
BbsI GAAGAC 1 cut(s) 153
BcoDI GTCTC 1 cut(s) 127
BfaI CTAG 1 cut(s) 98
BpiI GAAGAC 1 cut(s) 153
Bsa29I ATCGAT 1 cut(s) 125
BsaHI GRCGYC 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 50
BseCI ATCGAT 1 cut(s) 125
BseDI CCNNGG 1 cut(s) 50
BseGI GGATG 1 cut(s) 124
BshVI ATCGAT 1 cut(s) 125
BsiSI CCGG 1 cut(s) 111
BsmAI GTCTC 1 cut(s) 127
BspDI ATCGAT 1 cut(s) 125
BspQI GCTCTTC 1 cut(s) 154
BssECI CCNNGG 1 cut(s) 50
BssNI GRCGYC 1 cut(s) 47
BssT1I CCWWGG 1 cut(s) 50
Bst6I CTCTTC 2 cut(s) 154, 180
BstACI GRCGYC 1 cut(s) 47
BstF5I GGATG 1 cut(s) 124
BstMAI GTCTC 1 cut(s) 127
BstV2I GAAGAC 1 cut(s) 153
Bsu15I ATCGAT 1 cut(s) 125
BsuTUI ATCGAT 1 cut(s) 125
BtsCI GGATG 1 cut(s) 124
ClaI ATCGAT 1 cut(s) 125
CseI GACGC 1 cut(s) 55
CviJI RGCY 1 cut(s) 9
CviKI_1 RGCY 1 cut(s) 9
Eam1104I CTCTTC 2 cut(s) 154, 180
EarI CTCTTC 2 cut(s) 154, 180
Eco130I CCWWGG 1 cut(s) 50
EcoT14I CCWWGG 1 cut(s) 50
ErhI CCWWGG 1 cut(s) 50
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 98
HapII CCGG 1 cut(s) 111
HgaI GACGC 1 cut(s) 55
Hin1I GRCGYC 1 cut(s) 47
HinfI GANTC 1 cut(s) 122
HpaII CCGG 1 cut(s) 111
Hpy166II GTNNAC 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 208
Hpy8I GTNNAC 1 cut(s) 91
Hpy99I CGWCG 4 cut(s) 155, 158, 182, 185
HpyAV CCTTC 1 cut(s) 58
Hsp92I GRCGYC 1 cut(s) 47
LguI GCTCTTC 1 cut(s) 154
LpnPI CCDG 1 cut(s) 124
MaeI CTAG 1 cut(s) 98
MboII GAAGA 3 cut(s) 158, 171, 197
MluCI AATT 2 cut(s) 36, 194
MnlI CCTC 4 cut(s) 19, 109, 166, 181
MseI TTAA 2 cut(s) 197, 211
MspI CCGG 1 cut(s) 111
PciSI GCTCTTC 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 189
PfeI GAWTC 1 cut(s) 122
PshBI ATTAAT 1 cut(s) 197
SapI GCTCTTC 1 cut(s) 154
SaqAI TTAA 2 cut(s) 197, 211
SetI ASST 1 cut(s) 11
SgeI CNNG 8 cut(s) 22, 63, 100, 110, 119, 123, 149, 177
Sse9I AATT 2 cut(s) 36, 194
SspMI CTAG 1 cut(s) 98
StyI CCWWGG 1 cut(s) 50
TaqI TCGA 1 cut(s) 125
TasI AATT 2 cut(s) 36, 194
TfiI GAWTC 1 cut(s) 122
Tru1I TTAA 2 cut(s) 197, 211
Tru9I TTAA 2 cut(s) 197, 211
TspDTI ATGAA 3 cut(s) 17, 135, 159
TspGWI ACGGA 1 cut(s) 171
VspI ATTAAT 1 cut(s) 197
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.