AT3G05725

Domain of unknown function (DUF3511)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
1692510 .. 1693378
869 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G05725.1

Sequence Viewer

Length: 375 bp
ATGGAGGAATTCCAATCTCCTAGAATACGATCTTACAAATCGTATGAAGGAGATAGGAACCTCCAACTGGTTAATCCTGCAGATTTAAAACTGGTCAGAGGGATATATGTTGTTAGAGAATCGAGGCGCAATCGATCTCCGATAAAAACAGATATATGGCGCAAGATGTCTTACAAAGACATGCCCGTTAGACCGAGAAGATCTTCTTCTCATTCGACATTGTTCAAAGGATGGTGGAACGATCCGGAGATAAAGAGAAAGAGACGAGTGGCGAAATACAAACTCTATTCAGCCGAAGGGAAGATGAAGATAACTTTGAGAAAGAGTTACAAATGGATTAAGATCCAATGCTCGAAGATCATTCATGGAATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.99

Weight (kDa)

10.6

Isoelectric Point (pI)

72.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3511 PF12023 79 - 123 6.9e-24 Domain of unknown function (DUF3511)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016061)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G05725
fragaria_vesca FvH4_6g07171
malus_domestica MD04G1195600.v1.1 MD12G1207900.v1.1
prunus_persica Prupe.6G315400_v2.0.a1
pyrus_communis pycom12g19540
rosa_chinensis RchiOBHm_Chr3g0456821
rosa_laevigata RLG00000025276
rosa_multiflora Rmu_sc0000133.1_g000021 Rmu_sc0011688.1_g000008
rosa_roxburghii Rroxscaffold_6G00422470
rosa_rugosa Rorug03G0016000
rosa_samantha Rh3AG076300 Rh3DG080000
rosa_wichuraiana Rw3G006550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 244
AclWI GGATC 2 cut(s) 236, 337
AcsI RAATTY 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 67
AgsI TTSAA 1 cut(s) 226
Alw26I GTCTC 1 cut(s) 256
AlwI GGATC 2 cut(s) 236, 337
Aor13HI TCCGGA 1 cut(s) 244
ApoI RAATTY 1 cut(s) 8
Asp700I GAANNNNTTC 1 cut(s) 202
AspLEI GCGC 2 cut(s) 129, 162
BccI CCATC 1 cut(s) 225
BcoDI GTCTC 1 cut(s) 256
BfaI CTAG 1 cut(s) 21
BfmI CTRYAG 1 cut(s) 78
BglII AGATCT 1 cut(s) 200
BmiI GGNNCC 1 cut(s) 59
Bsa29I ATCGAT 1 cut(s) 133
BsaBI GATNNNNATC 1 cut(s) 341
BsaWI WCCGGW 1 cut(s) 244
Bsc4I CCNNNNNNNGG 1 cut(s) 67
Bse1I ACTGG 2 cut(s) 72, 96
Bse8I GATNNNNATC 1 cut(s) 341
BseAI TCCGGA 1 cut(s) 244
BseCI ATCGAT 1 cut(s) 133
BseGI GGATG 1 cut(s) 236
BseJI GATNNNNATC 1 cut(s) 341
BseLI CCNNNNNNNGG 1 cut(s) 67
BseNI ACTGG 2 cut(s) 72, 96
BshVI ATCGAT 1 cut(s) 133
BsiSI CCGG 1 cut(s) 245
BslI CCNNNNNNNGG 1 cut(s) 67
BsmAI GTCTC 1 cut(s) 256
BsmBI CGTCTC 1 cut(s) 256
Bsp13I TCCGGA 1 cut(s) 244
Bsp143I GATC 6 cut(s) 29, 134, 200, 241, 342, 357
BspDI ATCGAT 1 cut(s) 133
BspEI TCCGGA 1 cut(s) 244
BspLI GGNNCC 1 cut(s) 59
BspMAI CTGCAG 1 cut(s) 82
BspPI GGATC 2 cut(s) 236, 337
BsrI ACTGG 2 cut(s) 72, 96
BssMI GATC 6 cut(s) 29, 134, 200, 241, 342, 357
BstF5I GGATG 1 cut(s) 236
BstHHI GCGC 2 cut(s) 129, 162
BstKTI GATC 6 cut(s) 32, 137, 203, 244, 345, 360
BstMAI GTCTC 1 cut(s) 256
BstMBI GATC 6 cut(s) 29, 134, 200, 241, 342, 357
BstNSI RCATGY 1 cut(s) 184
BstSFI CTRYAG 1 cut(s) 78
BstX2I RGATCY 2 cut(s) 200, 342
BstYI RGATCY 2 cut(s) 200, 342
Bsu15I ATCGAT 1 cut(s) 133
BsuTUI ATCGAT 1 cut(s) 133
BtsCI GGATG 1 cut(s) 236
CfoI GCGC 2 cut(s) 129, 162
ClaI ATCGAT 1 cut(s) 133
CviAII CATG 2 cut(s) 181, 365
CviJI RGCY 1 cut(s) 293
CviKI_1 RGCY 1 cut(s) 293
DpnI GATC 6 cut(s) 31, 136, 202, 243, 344, 359
DpnII GATC 6 cut(s) 29, 134, 200, 241, 342, 357
DraI TTTAAA 1 cut(s) 87
EcoRI GAATTC 1 cut(s) 8
Esp3I CGTCTC 1 cut(s) 256
FaeI CATG 2 cut(s) 184, 368
FaiI YATR 8 cut(s) 45, 106, 108, 155, 157, 182, 366, 373
FalI AAGNNNNNCTT 2 cut(s) 190, 222
FatI CATG 2 cut(s) 180, 364
FokI GGATG 1 cut(s) 243
FspBI CTAG 1 cut(s) 21
GlaI GCGC 2 cut(s) 128, 161
HapII CCGG 1 cut(s) 245
HhaI GCGC 2 cut(s) 129, 162
Hin1II CATG 2 cut(s) 184, 368
Hin6I GCGC 2 cut(s) 127, 160
HinP1I GCGC 2 cut(s) 127, 160
HinfI GANTC 1 cut(s) 119
HpaII CCGG 1 cut(s) 245
Hpy188I TCNGA 2 cut(s) 98, 141
Hpy188III TCNNGA 1 cut(s) 245
HpyAV CCTTC 2 cut(s) 41, 290
HpyCH4V TGCA 1 cut(s) 80
Hsp92II CATG 2 cut(s) 184, 368
HspAI GCGC 2 cut(s) 127, 160
Kpn2I TCCGGA 1 cut(s) 244
Kzo9I GATC 6 cut(s) 29, 134, 200, 241, 342, 357
LpnPI CCDG 4 cut(s) 53, 77, 90, 258
MaeI CTAG 1 cut(s) 21
MaeIII GTNAC 1 cut(s) 326
MalI GATC 6 cut(s) 31, 136, 202, 243, 344, 359
MboI GATC 6 cut(s) 29, 134, 200, 241, 342, 357
MboII GAAGA 6 cut(s) 195, 198, 210, 313, 319, 367
MflI RGATCY 2 cut(s) 200, 342
MluCI AATT 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 3 cut(s) 71, 92, 117
MroI TCCGGA 1 cut(s) 244
MroXI GAANNNNTTC 1 cut(s) 202
MseI TTAA 3 cut(s) 72, 86, 339
MspI CCGG 1 cut(s) 245
NdeII GATC 6 cut(s) 29, 134, 200, 241, 342, 357
NlaIII CATG 2 cut(s) 184, 368
NlaIV GGNNCC 1 cut(s) 59
NspI RCATGY 1 cut(s) 184
PdmI GAANNNNTTC 1 cut(s) 202
PfeI GAWTC 1 cut(s) 119
PspN4I GGNNCC 1 cut(s) 59
PstI CTGCAG 1 cut(s) 82
PsuI RGATCY 2 cut(s) 200, 342
SaqAI TTAA 3 cut(s) 72, 86, 339
Sau3AI GATC 6 cut(s) 29, 134, 200, 241, 342, 357
SetI ASST 1 cut(s) 63
SfcI CTRYAG 1 cut(s) 78
Sse9I AATT 1 cut(s) 8
SspMI CTAG 1 cut(s) 21
TaqI TCGA 4 cut(s) 122, 133, 215, 353
TaqII GACCGA 1 cut(s) 208
TasI AATT 1 cut(s) 8
TfiI GAWTC 1 cut(s) 119
Tru1I TTAA 3 cut(s) 72, 86, 339
Tru9I TTAA 3 cut(s) 72, 86, 339
TspDTI ATGAA 3 cut(s) 60, 320, 353
XapI RAATTY 1 cut(s) 8
XceI RCATGY 1 cut(s) 184
XmnI GAANNNNTTC 1 cut(s) 202
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.