AT3G06680

60s ribosomal protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
2114151 .. 2114948
798 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G06680.1

Sequence Viewer

Length: 252 bp
ATGTCACCTATCTTTCCTCTCGCGTCTCTCCCCTTTACTCAGTTGTGTTGTGCCGTTGTTACAGAAATGGCGAAATCGAAGAATCACACGGCGCACAATCAGTCTGCCAAGGCGCATAAGAACGGAATCAAGAAGCCAAGGAGACACCGTCACACACCAACCAGAGGAATGGATCCTAAATTCCTAAGAAACCAGAGGTATGCAAGGAAGCACAACGTCAAGAGTGGCGAGAATGCTGGTGTCGAAGAGTAG

Protein Analysis

83

Amino Acids

9.39

Weight (kDa)

10.55

Isoelectric Point (pI)

50.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L29e PF01779 25 - 64 3.4e-22 Ribosomal L29e protein family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 23
AclWI GGATC 2 cut(s) 167, 180
AcsI RAATTY 1 cut(s) 179
AfiI CCNNNNNNNGG 1 cut(s) 164
Alw26I GTCTC 2 cut(s) 30, 136
AlwI GGATC 2 cut(s) 167, 180
ApoI RAATTY 1 cut(s) 179
AspLEI GCGC 2 cut(s) 94, 115
BamHI GGATCC 1 cut(s) 172
BceAI ACGGC 2 cut(s) 38, 105
BcoDI GTCTC 2 cut(s) 30, 136
BmiI GGNNCC 1 cut(s) 174
BsaJI CCNNGG 2 cut(s) 108, 137
BsaXI ACNNNNNCTCC 2 cut(s) 133, 163
Bsc4I CCNNNNNNNGG 1 cut(s) 164
BseDI CCNNGG 2 cut(s) 108, 137
BseLI CCNNNNNNNGG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 53
Bsh1236I CGCG 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 164
BsmAI GTCTC 2 cut(s) 30, 136
BsmBI CGTCTC 1 cut(s) 30
BsmI GAATGC 1 cut(s) 238
Bsp143I GATC 1 cut(s) 172
BspCNI CTCAG 1 cut(s) 52
BspFNI CGCG 1 cut(s) 23
BspLI GGNNCC 1 cut(s) 174
BspPI GGATC 2 cut(s) 167, 180
BssECI CCNNGG 2 cut(s) 108, 137
BssMI GATC 1 cut(s) 172
BssT1I CCWWGG 2 cut(s) 108, 137
Bst4CI ACNGT 1 cut(s) 149
Bst6I CTCTTC 1 cut(s) 240
BstDEI CTNAG 2 cut(s) 39, 185
BstFNI CGCG 1 cut(s) 23
BstHHI GCGC 2 cut(s) 94, 115
BstKTI GATC 1 cut(s) 175
BstMAI GTCTC 2 cut(s) 30, 136
BstMBI GATC 1 cut(s) 172
BstUI CGCG 1 cut(s) 23
BstX2I RGATCY 1 cut(s) 172
BstXI CCANNNNNNTGG 1 cut(s) 169
BstYI RGATCY 1 cut(s) 172
CfoI GCGC 2 cut(s) 94, 115
CseI GACGC 1 cut(s) 12
CviJI RGCY 1 cut(s) 136
CviKI_1 RGCY 1 cut(s) 136
DdeI CTNAG 2 cut(s) 39, 185
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
Eam1104I CTCTTC 1 cut(s) 240
EarI CTCTTC 1 cut(s) 240
Eco130I CCWWGG 2 cut(s) 108, 137
EcoT14I CCWWGG 2 cut(s) 108, 137
ErhI CCWWGG 2 cut(s) 108, 137
Esp3I CGTCTC 1 cut(s) 30
FaiI YATR 2 cut(s) 117, 201
GlaI GCGC 2 cut(s) 93, 114
HgaI GACGC 1 cut(s) 12
HhaI GCGC 2 cut(s) 94, 115
Hin6I GCGC 2 cut(s) 92, 113
HinP1I GCGC 2 cut(s) 92, 113
HinfI GANTC 2 cut(s) 82, 126
Hpy188III TCNNGA 2 cut(s) 130, 220
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 216
HpyCH4V TGCA 1 cut(s) 203
HpyF3I CTNAG 2 cut(s) 39, 185
HpySE526I ACGT 1 cut(s) 216
HspAI GCGC 2 cut(s) 92, 113
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 3 cut(s) 175, 206, 222
MaeII ACGT 1 cut(s) 216
MaeIII GTNAC 3 cut(s) 3, 58, 149
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MboII GAAGA 1 cut(s) 91
MflI RGATCY 1 cut(s) 172
MluCI AATT 1 cut(s) 179
MnlI CCTC 3 cut(s) 27, 158, 189
Mva1269I GAATGC 1 cut(s) 238
MvnI CGCG 1 cut(s) 23
NdeII GATC 1 cut(s) 172
NlaIV GGNNCC 1 cut(s) 174
NmuCI GTSAC 2 cut(s) 3, 149
PctI GAATGC 1 cut(s) 238
PfeI GAWTC 2 cut(s) 82, 126
PflFI GACNNNGTC 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 174
PsuI RGATCY 1 cut(s) 172
PsyI GACNNNGTC 1 cut(s) 147
Sau3AI GATC 1 cut(s) 172
SetI ASST 3 cut(s) 10, 200, 219
Sse9I AATT 1 cut(s) 179
StyI CCWWGG 2 cut(s) 108, 137
TaaI ACNGT 1 cut(s) 149
TaiI ACGT 1 cut(s) 219
TaqI TCGA 2 cut(s) 77, 243
TasI AATT 1 cut(s) 179
TfiI GAWTC 2 cut(s) 82, 126
TseFI GTSAC 2 cut(s) 3, 149
Tsp45I GTSAC 2 cut(s) 3, 149
TspGWI ACGGA 1 cut(s) 138
Tth111I GACNNNGTC 1 cut(s) 147
XapI RAATTY 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.