Prupe.1G122500_v2.0.a1

Belongs to the eukaryotic ribosomal protein eL29 family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
9615920 .. 9616800
881 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G122500.1

Sequence Viewer

Length: 186 bp
ATGGCCAAGTCGAAGAACCACACCGCTCACAACCAGTCCCGCAAGGCTCACAGGAACGGCATCAAGAAGCCTCAGAGGCACCGCCACACTTCAACCAAAGGGATGGACCCCAAGTTCCTGCGGAACCAAAGGTACGCCAGGAAGCACAACAACACCAAGAACGAATCAGCCACCGAGGAAGAATAG

Protein Analysis

62

Amino Acids

7.22

Weight (kDa)

11.09

Isoelectric Point (pI)

49.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 78
AccBSI CCGCTC 1 cut(s) 26
AciI CCGC 4 cut(s) 24, 40, 82, 121
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 134
AgsI TTSAA 1 cut(s) 93
AjnI CCWGG 1 cut(s) 137
AloI GAACNNNNNNTCC 2 cut(s) 98, 130
AoxI GGCC 1 cut(s) 3
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BalI TGGCCA 1 cut(s) 5
BanI GGYRCC 1 cut(s) 78
BccI CCATC 1 cut(s) 97
BceAI ACGGC 1 cut(s) 73
BciT130I CCWGG 1 cut(s) 139
BglI GCCNNNNNGGC 1 cut(s) 76
Bme1390I CCNGG 1 cut(s) 139
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 3 cut(s) 80, 108, 125
BmrFI CCNGG 1 cut(s) 139
BmsI GCATC 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 174
Bse1I ACTGG 1 cut(s) 34
BseBI CCWGG 1 cut(s) 139
BseDI CCNNGG 1 cut(s) 174
BseGI GGATG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 86
BseNI ACTGG 1 cut(s) 34
BshFI GGCC 1 cut(s) 5
BshNI GGYRCC 1 cut(s) 78
BslFI GGGAC 1 cut(s) 22
BsmFI GGGAC 1 cut(s) 22
BsnI GGCC 1 cut(s) 5
BspACI CCGC 4 cut(s) 24, 40, 82, 121
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 85
BspLI GGNNCC 3 cut(s) 80, 108, 125
BspT107I GGYRCC 1 cut(s) 78
BsrBI CCGCTC 1 cut(s) 26
BsrI ACTGG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 174
Bst2UI CCWGG 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 108
BstMWI GCNNNNNNNGC 1 cut(s) 76
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 137
BstXI CCANNNNNNTGG 1 cut(s) 103
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 106
Csp6I GTAC 1 cut(s) 133
CviJI RGCY 4 cut(s) 5, 47, 70, 170
CviKI_1 RGCY 4 cut(s) 5, 47, 70, 170
CviQI GTAC 1 cut(s) 133
DdeI CTNAG 1 cut(s) 72
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 106
EcoRII CCWGG 1 cut(s) 137
FaqI GGGAC 1 cut(s) 22
FauI CCCGC 1 cut(s) 47
FokI GGATG 1 cut(s) 115
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 164
Hpy188I TCNGA 1 cut(s) 75
Hpy188III TCNNGA 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 76
HpyF3I CTNAG 1 cut(s) 72
LpnPI CCDG 5 cut(s) 37, 47, 124, 131, 151
LweI GCATC 1 cut(s) 69
MbiI CCGCTC 1 cut(s) 26
MboII GAAGA 1 cut(s) 25
MlsI TGGCCA 1 cut(s) 5
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 3 cut(s) 69, 81, 169
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 139
MvaI CCWGG 1 cut(s) 139
MwoI GCNNNNNNNGC 1 cut(s) 76
NlaIV GGNNCC 3 cut(s) 80, 108, 125
PfeI GAWTC 1 cut(s) 164
Psp6I CCWGG 1 cut(s) 137
PspGI CCWGG 1 cut(s) 137
PspN4I GGNNCC 3 cut(s) 80, 108, 125
PspPI GGNCC 1 cut(s) 106
PsrI GAACNNNNNNTAC 2 cut(s) 116, 148
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
Sau96I GGNCC 1 cut(s) 106
ScrFI CCNGG 1 cut(s) 139
SetI ASST 1 cut(s) 134
SfaNI GCATC 1 cut(s) 69
SinI GGWCC 1 cut(s) 106
SsiI CCGC 4 cut(s) 24, 40, 82, 121
StyD4I CCNGG 1 cut(s) 137
TaqI TCGA 1 cut(s) 11
TfiI GAWTC 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.