pycom16g13260

Belongs to the eukaryotic ribosomal protein eL29 family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
9436434 .. 9437229
796 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g13260.3

Sequence Viewer

Length: 261 bp
ATGAAAATTGTGGAAGTGTATGAAGACGAATCCTGGCCAACATTTGTTTATCAAATCCATCGTTCTCTTTCCGAGATGGCCAAGTCGAAGAATCACACCGCCCACAACCAGTCCCGAAAGGCCCACAGGAACGGCATCAAGAAGCCTAAGAGGCACCGCCACACTTCCACCAAAGGGATGGACCCCAAGTTTCTGAGGAACCAGAGGTACGCCAGGAAGCACAACAACACCAAGAACGAATCCGCCTCTGATGAAGAGTAG

Protein Analysis

87

Amino Acids

10.26

Weight (kDa)

10.11

Isoelectric Point (pI)

43.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 153
AciI CCGC 3 cut(s) 99, 157, 243
AcoI YGGCCR 2 cut(s) 35, 78
AfaI GTAC 1 cut(s) 209
AfiI CCNNNNNNNGG 1 cut(s) 174
AjnI CCWGG 2 cut(s) 32, 212
AoxI GGCC 3 cut(s) 35, 78, 120
AspS9I GGNCC 2 cut(s) 121, 181
AvaII GGWCC 1 cut(s) 181
BalI TGGCCA 2 cut(s) 37, 80
BanI GGYRCC 1 cut(s) 153
BbsI GAAGAC 1 cut(s) 30
BccI CCATC 3 cut(s) 66, 70, 172
BceAI ACGGC 1 cut(s) 148
BciT130I CCWGG 2 cut(s) 34, 214
BglI GCCNNNNNGGC 1 cut(s) 151
Bme1390I CCNGG 2 cut(s) 34, 214
Bme18I GGWCC 1 cut(s) 181
BmgT120I GGNCC 2 cut(s) 121, 181
BmiI GGNNCC 3 cut(s) 155, 183, 200
BmrFI CCNGG 2 cut(s) 34, 214
BmsI GCATC 1 cut(s) 144
BpiI GAAGAC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 174
Bse1I ACTGG 1 cut(s) 109
BseBI CCWGG 2 cut(s) 34, 214
BseGI GGATG 1 cut(s) 183
BseLI CCNNNNNNNGG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 185
BseNI ACTGG 1 cut(s) 109
BshFI GGCC 3 cut(s) 37, 80, 122
BshNI GGYRCC 1 cut(s) 153
BslFI GGGAC 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 174
BsmFI GGGAC 1 cut(s) 97
BsnI GGCC 3 cut(s) 37, 80, 122
BspACI CCGC 3 cut(s) 99, 157, 243
BspANI GGCC 3 cut(s) 37, 80, 122
BspCNI CTCAG 1 cut(s) 186
BspLI GGNNCC 3 cut(s) 155, 183, 200
BspT107I GGYRCC 1 cut(s) 153
BsrI ACTGG 1 cut(s) 109
Bst2UI CCWGG 2 cut(s) 34, 214
Bst6I CTCTTC 1 cut(s) 249
BstDEI CTNAG 2 cut(s) 147, 194
BstF5I GGATG 1 cut(s) 183
BstMWI GCNNNNNNNGC 1 cut(s) 151
BstNI CCWGG 2 cut(s) 34, 214
BstSCI CCNGG 2 cut(s) 32, 212
BstV2I GAAGAC 1 cut(s) 30
BstXI CCANNNNNNTGG 1 cut(s) 178
BsuRI GGCC 3 cut(s) 37, 80, 122
BtsCI GGATG 1 cut(s) 183
Cfr13I GGNCC 2 cut(s) 121, 181
Csp6I GTAC 1 cut(s) 208
CviJI RGCY 4 cut(s) 37, 80, 122, 145
CviKI_1 RGCY 4 cut(s) 37, 80, 122, 145
CviQI GTAC 1 cut(s) 208
DdeI CTNAG 2 cut(s) 147, 194
EaeI YGGCCR 2 cut(s) 35, 78
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
EciI GGCGGA 1 cut(s) 232
Eco47I GGWCC 1 cut(s) 181
EcoRII CCWGG 2 cut(s) 32, 212
FaiI YATR 1 cut(s) 21
FaqI GGGAC 1 cut(s) 97
FokI GGATG 1 cut(s) 190
HaeIII GGCC 3 cut(s) 37, 80, 122
HinfI GANTC 3 cut(s) 29, 91, 239
Hpy188I TCNGA 3 cut(s) 73, 195, 250
Hpy188III TCNNGA 2 cut(s) 114, 139
HpyF10VI GCNNNNNNNGC 1 cut(s) 151
HpyF3I CTNAG 2 cut(s) 147, 194
LpnPI CCDG 7 cut(s) 19, 46, 112, 122, 199, 215, 226
LweI GCATC 1 cut(s) 144
MboII GAAGA 2 cut(s) 35, 100
MlsI TGGCCA 2 cut(s) 37, 80
MluCI AATT 1 cut(s) 6
MluNI TGGCCA 2 cut(s) 37, 80
MnlI CCTC 4 cut(s) 144, 189, 198, 256
Mox20I TGGCCA 2 cut(s) 37, 80
MscI TGGCCA 2 cut(s) 37, 80
Msp20I TGGCCA 2 cut(s) 37, 80
MspR9I CCNGG 2 cut(s) 34, 214
MvaI CCWGG 2 cut(s) 34, 214
MwoI GCNNNNNNNGC 1 cut(s) 151
NlaIV GGNNCC 3 cut(s) 155, 183, 200
PfeI GAWTC 3 cut(s) 29, 91, 239
Psp6I CCWGG 2 cut(s) 32, 212
PspGI CCWGG 2 cut(s) 32, 212
PspN4I GGNNCC 3 cut(s) 155, 183, 200
PspPI GGNCC 2 cut(s) 121, 181
PsrI GAACNNNNNNTAC 2 cut(s) 191, 223
RsaI GTAC 1 cut(s) 209
RsaNI GTAC 1 cut(s) 208
Sau96I GGNCC 2 cut(s) 121, 181
ScrFI CCNGG 2 cut(s) 34, 214
SetI ASST 1 cut(s) 209
SfaNI GCATC 1 cut(s) 144
SinI GGWCC 1 cut(s) 181
Sse9I AATT 1 cut(s) 6
SsiI CCGC 3 cut(s) 99, 157, 243
StyD4I CCNGG 2 cut(s) 32, 212
TaqI TCGA 1 cut(s) 86
TasI AATT 1 cut(s) 6
TfiI GAWTC 3 cut(s) 29, 91, 239
TspDTI ATGAA 2 cut(s) 17, 36
VpaK11BI GGWCC 1 cut(s) 181
XcmI CCANNNNNNNNNTGG 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.