AT3G27100

Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates to a subcomplex that specifically deubiquitinates histones. The SAGA complex is recruited to specific gene promoters by activators, where it is required for transcription. The TREX-2 complex functions in docking export-competent ribonucleoprotein particles (mRNPs) to the nuclear entrance of the nuclear pore complex (nuclear basket). TREX-2 participates in mRNA export and accurate chromatin positioning in the nucleus by tethering genes to the nuclear periphery

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
9994481 .. 9996115
1635 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G27100.1

Sequence Viewer

Length: 348 bp
ATGAAACATTCGGTGAATCGGCCTCCGACACCAGATGAAGACGATGTGGCGGATGGTTTCGAGAAAGACAAGGTCACGCTTCGAGAAATCATCAACGTCAAGTTGGTGGAGAGTGGAGAGAAGGAGAATCTAATGGAGCTTGTGAGAGATAGATTGGTGGAGTGTGGTTGGAAAGATGAGATGAGAATTGCTTGCAGGGAGCATGTAAAGAAGAAAGGGAGAAAAGATGTTACAGTCGATGAACTGATCCGAGTGATCACTCCTAAAGGCAGAGCTTCAGTACCAGATTCTGTGAAGGCAGAGCTGTTGAACAGAATTCAAAACTTCATTGTATCAGCTGCTCTTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

13.11

Weight (kDa)

6.74

Isoelectric Point (pI)

18.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EnY2 PF10163 29 - 110 1.9e-28 Transcription factor e(y)2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015292)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27100 AT3G27100
fragaria_vesca FvH4_6g53480 FvH4_6g53480
malus_domestica MD00G1139400.v1.1 MD09G1011100.v1.1
prunus_persica Prupe.3G305900_v2.0.a1 Prupe.3G305900_v2.0.a1
pyrus_communis pycom111g00940
rosa_chinensis RchiOBHm_Chr2g0175521
rosa_laevigata RLG00000022335
rosa_multiflora Rmu_sc0021955.1_g000007
rosa_roxburghii Rroxscaffold_2G00077240
rosa_rugosa Rorug02G0585800
rosa_samantha Rh2CG639000
rosa_wichuraiana Rw2G054510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AclWI GGATC 1 cut(s) 241
AcsI RAATTY 1 cut(s) 315
AcuI CTGAAG 1 cut(s) 261
AfaI GTAC 1 cut(s) 282
AgsI TTSAA 2 cut(s) 310, 320
AluBI AGCT 4 cut(s) 139, 275, 304, 338
AluI AGCT 4 cut(s) 139, 275, 304, 338
AlwI GGATC 1 cut(s) 241
AlwNI CAGNNNCTG 1 cut(s) 290
AoxI GGCC 1 cut(s) 20
ApeKI GCWGC 1 cut(s) 338
ApoI RAATTY 1 cut(s) 315
AsuHPI GGTGA 1 cut(s) 25
BbsI GAAGAC 1 cut(s) 45
BbvI GCAGC 1 cut(s) 325
BccI CCATC 1 cut(s) 47
BclI TGATCA 1 cut(s) 255
BisI GCNGC 1 cut(s) 339
BlsI GCNGC 1 cut(s) 340
BpiI GAAGAC 1 cut(s) 45
BseGI GGATG 1 cut(s) 58
BseXI GCAGC 1 cut(s) 325
BshFI GGCC 1 cut(s) 22
BsnI GGCC 1 cut(s) 22
Bsp143I GATC 2 cut(s) 246, 255
BspACI CCGC 1 cut(s) 50
BspANI GGCC 1 cut(s) 22
BspPI GGATC 1 cut(s) 241
BssMI GATC 2 cut(s) 246, 255
Bst4CI ACNGT 1 cut(s) 235
BstC8I GCNNGC 1 cut(s) 193
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 2 cut(s) 249, 258
BstMBI GATC 2 cut(s) 246, 255
BstNSI RCATGY 1 cut(s) 206
BstV1I GCAGC 1 cut(s) 325
BstV2I GAAGAC 1 cut(s) 45
BsuRI GGCC 1 cut(s) 22
BtsCI GGATG 1 cut(s) 58
Cac8I GCNNGC 1 cut(s) 193
CaiI CAGNNNCTG 1 cut(s) 290
Csp6I GTAC 1 cut(s) 281
CviAII CATG 1 cut(s) 203
CviJI RGCY 5 cut(s) 22, 139, 275, 304, 338
CviKI_1 RGCY 5 cut(s) 22, 139, 275, 304, 338
CviQI GTAC 1 cut(s) 281
DpnI GATC 2 cut(s) 248, 257
DpnII GATC 2 cut(s) 246, 255
EciI GGCGGA 1 cut(s) 65
Eco57I CTGAAG 1 cut(s) 261
EcoRI GAATTC 1 cut(s) 315
FaeI CATG 1 cut(s) 206
FaiI YATR 1 cut(s) 204
FatI CATG 1 cut(s) 202
FbaI TGATCA 1 cut(s) 255
Fnu4HI GCNGC 1 cut(s) 339
FokI GGATG 1 cut(s) 65
Fsp4HI GCNGC 1 cut(s) 339
GluI GCNGC 1 cut(s) 339
HaeIII GGCC 1 cut(s) 22
Hin1II CATG 1 cut(s) 206
HinfI GANTC 3 cut(s) 16, 127, 287
HphI GGTGA 1 cut(s) 25
Hpy188I TCNGA 2 cut(s) 27, 251
Hpy188III TCNNGA 2 cut(s) 61, 83
HpyAV CCTTC 2 cut(s) 115, 289
HpyCH4III ACNGT 1 cut(s) 235
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 195
HpySE526I ACGT 1 cut(s) 96
Hsp92II CATG 1 cut(s) 206
Ksp22I TGATCA 1 cut(s) 255
Kzo9I GATC 2 cut(s) 246, 255
LmnI GCTCC 2 cut(s) 136, 199
LpnPI CCDG 3 cut(s) 45, 181, 297
Lsp1109I GCAGC 1 cut(s) 325
MaeII ACGT 1 cut(s) 96
MaeIII GTNAC 2 cut(s) 73, 229
MalI GATC 2 cut(s) 248, 257
MboI GATC 2 cut(s) 246, 255
MboII GAAGA 2 cut(s) 50, 223
MluCI AATT 2 cut(s) 186, 315
MmeI TCCRAC 2 cut(s) 50, 149
MnlI CCTC 1 cut(s) 33
MspA1I CMGCKG 1 cut(s) 338
NdeII GATC 2 cut(s) 246, 255
NlaIII CATG 1 cut(s) 206
NmuCI GTSAC 1 cut(s) 73
NspI RCATGY 1 cut(s) 206
PfeI GAWTC 3 cut(s) 16, 127, 287
PflFI GACNNNGTC 1 cut(s) 71
PkrI GCNGC 1 cut(s) 340
PstNI CAGNNNCTG 1 cut(s) 290
PsyI GACNNNGTC 1 cut(s) 71
PvuII CAGCTG 1 cut(s) 338
RsaI GTAC 1 cut(s) 282
RsaNI GTAC 1 cut(s) 281
SatI GCNGC 1 cut(s) 339
Sau3AI GATC 2 cut(s) 246, 255
SetI ASST 6 cut(s) 75, 99, 141, 277, 306, 340
Sse9I AATT 2 cut(s) 186, 315
SsiI CCGC 1 cut(s) 50
TaaI ACNGT 1 cut(s) 235
TaiI ACGT 1 cut(s) 99
TaqI TCGA 3 cut(s) 60, 82, 237
TasI AATT 2 cut(s) 186, 315
TfiI GAWTC 3 cut(s) 16, 127, 287
TseFI GTSAC 1 cut(s) 73
TseI GCWGC 1 cut(s) 338
Tsp45I GTSAC 1 cut(s) 73
TspDTI ATGAA 4 cut(s) 17, 51, 255, 316
Tth111I GACNNNGTC 1 cut(s) 71
XapI RAATTY 1 cut(s) 315
XceI RCATGY 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.