Rroxscaffold_2G00077240

Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates to a subcomplex that specifically deubiquitinates histones. The SAGA complex is recruited to specific gene promoters by activators, where it is required for transcription. The TREX-2 complex functions in docking export-competent ribonucleoprotein particles (mRNPs) to the nuclear entrance of the nuclear pore complex (nuclear basket). TREX-2 participates in mRNA export and accurate chromatin positioning in the nucleus by tethering genes to the nuclear periphery

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
842687 .. 851173
8487 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00077240.1

Sequence Viewer

Length: 393 bp
ATGGGACGGTTTTGCGGAATATTCTTGAAGCCCCAAACGTTGGACAGCATAAAAATGAGGAAATCGGTGAATCGTCAGTCGACGCCGGATGTTGAGGAGAATCAAGAAGACAAGGAGCCCAGTTTCCAAGAGCTCATCAACATCGAGTTGATTGAGAGCGGTGAAAAGGAGCGGTTAATGGAGCTACTGAGGGAGAGGCTAATTGAGTGTGGGTGGAAGGATGAAATGAAAGCTCTTTGCAGGTCATTCATAAAGAAAAAAGGAAGGAACAATGTTACTGTGGATGACCTTGTACATGTAATCACCCCAAAGGGCAGAGCCTCCATTCCTGATTCCGTAAAGGCAGAGCTTTTGCAAAGGATTCGTACGTTCCTGATGTCAGCAGCTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

15.01

Weight (kDa)

8.47

Isoelectric Point (pI)

53.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EnY2 PF10163 45 - 125 1.1e-31 Transcription factor e(y)2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015292)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27100 AT3G27100
fragaria_vesca FvH4_6g53480 FvH4_6g53480
malus_domestica MD00G1139400.v1.1 MD09G1011100.v1.1
prunus_persica Prupe.3G305900_v2.0.a1 Prupe.3G305900_v2.0.a1
pyrus_communis pycom111g00940
rosa_chinensis RchiOBHm_Chr2g0175521
rosa_laevigata RLG00000022335
rosa_multiflora Rmu_sc0021955.1_g000007
rosa_roxburghii Rroxscaffold_2G00077240
rosa_rugosa Rorug02G0585800
rosa_samantha Rh2CG639000
rosa_wichuraiana Rw2G054510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 231
AccB7I CCANNNNNTGG 1 cut(s) 40
AccBSI CCGCTC 2 cut(s) 159, 172
AccI GTMKAC 1 cut(s) 80
AciI CCGC 3 cut(s) 15, 159, 172
AclI AACGTT 1 cut(s) 38
AcyI GRCGYC 1 cut(s) 83
AfaI GTAC 2 cut(s) 294, 367
AfiI CCNNNNNNNGG 1 cut(s) 40
AflIII ACRYGT 1 cut(s) 295
AgsI TTSAA 1 cut(s) 28
AluBI AGCT 5 cut(s) 133, 184, 233, 349, 386
AluI AGCT 5 cut(s) 133, 184, 233, 349, 386
Alw21I GWGCWC 1 cut(s) 135
ApeKI GCWGC 1 cut(s) 383
AsuHPI GGTGA 3 cut(s) 79, 173, 295
BanII GRGCYC 2 cut(s) 120, 135
BbsI GAAGAC 1 cut(s) 114
Bbv12I GWGCWC 1 cut(s) 135
BcgI CGANNNNNNTGC 2 cut(s) 344, 378
BfuAI ACCTGC 1 cut(s) 231
BisI GCNGC 1 cut(s) 384
BlsI GCNGC 1 cut(s) 385
BmiI GGNNCC 1 cut(s) 117
BmrI ACTGGG 1 cut(s) 114
BmuI ACTGGG 1 cut(s) 114
BpiI GAAGAC 1 cut(s) 114
BsaHI GRCGYC 1 cut(s) 83
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse1I ACTGG 1 cut(s) 120
BseGI GGATG 3 cut(s) 94, 226, 289
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 179
BseNI ACTGG 1 cut(s) 120
BseRI GAGGAG 1 cut(s) 110
BsiHKAI GWGCWC 1 cut(s) 135
BsiSI CCGG 1 cut(s) 86
BsiWI CGTACG 1 cut(s) 365
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 40
BsmFI GGGAC 1 cut(s) 18
Bsp1286I GDGCHC 2 cut(s) 120, 135
Bsp1407I TGTACA 1 cut(s) 292
BspACI CCGC 3 cut(s) 15, 159, 172
BspCNI CTCAG 1 cut(s) 180
BspLI GGNNCC 1 cut(s) 117
BspMI ACCTGC 1 cut(s) 231
BsrBI CCGCTC 2 cut(s) 159, 172
BsrGI TGTACA 1 cut(s) 292
BsrI ACTGG 1 cut(s) 120
BssNI GRCGYC 1 cut(s) 83
Bst4CI ACNGT 2 cut(s) 9, 280
BstACI GRCGYC 1 cut(s) 83
BstAUI TGTACA 1 cut(s) 292
BstDEI CTNAG 1 cut(s) 188
BstF5I GGATG 3 cut(s) 94, 226, 289
BstNSI RCATGY 1 cut(s) 299
BstV2I GAAGAC 1 cut(s) 114
BtsCI GGATG 3 cut(s) 94, 226, 289
BveI ACCTGC 1 cut(s) 231
CseI GACGC 1 cut(s) 91
Csp6I GTAC 2 cut(s) 293, 366
CviAII CATG 1 cut(s) 296
CviJI RGCY 9 cut(s) 31, 118, 133, 184, 199, 233, 320, 349, 386
CviKI_1 RGCY 9 cut(s) 31, 118, 133, 184, 199, 233, 320, 349, 386
CviQI GTAC 2 cut(s) 293, 366
DdeI CTNAG 1 cut(s) 188
Ecl136II GAGCTC 1 cut(s) 133
Eco24I GRGCYC 2 cut(s) 120, 135
Eco53kI GAGCTC 1 cut(s) 133
EcoICRI GAGCTC 1 cut(s) 133
EcoT38I GRGCYC 2 cut(s) 120, 135
FaeI CATG 1 cut(s) 299
FaiI YATR 3 cut(s) 50, 251, 297
FaqI GGGAC 1 cut(s) 18
FatI CATG 1 cut(s) 295
FblI GTMKAC 1 cut(s) 80
Fnu4HI GCNGC 1 cut(s) 384
FokI GGATG 3 cut(s) 101, 233, 296
FriOI GRGCYC 2 cut(s) 120, 135
Fsp4HI GCNGC 1 cut(s) 384
GluI GCNGC 1 cut(s) 384
HapII CCGG 1 cut(s) 86
HgaI GACGC 1 cut(s) 91
Hin1I GRCGYC 1 cut(s) 83
Hin1II CATG 1 cut(s) 299
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HinfI GANTC 4 cut(s) 70, 100, 332, 361
HpaII CCGG 1 cut(s) 86
HphI GGTGA 3 cut(s) 79, 173, 295
Hpy166II GTNNAC 1 cut(s) 81
Hpy188III TCNNGA 4 cut(s) 25, 104, 329, 373
Hpy8I GTNNAC 1 cut(s) 81
Hpy99I CGWCG 1 cut(s) 85
HpyAV CCTTC 2 cut(s) 211, 258
HpyCH4III ACNGT 2 cut(s) 9, 280
HpyCH4IV ACGT 2 cut(s) 38, 368
HpyCH4V TGCA 2 cut(s) 240, 355
HpyF3I CTNAG 1 cut(s) 188
HpySE526I ACGT 2 cut(s) 38, 368
Hsp92I GRCGYC 1 cut(s) 83
Hsp92II CATG 1 cut(s) 299
LmnI GCTCC 3 cut(s) 115, 169, 181
LpnPI CCDG 5 cut(s) 99, 133, 226, 342, 386
MaeII ACGT 2 cut(s) 38, 368
MaeIII GTNAC 1 cut(s) 274
MbiI CCGCTC 2 cut(s) 159, 172
MboII GAAGA 1 cut(s) 119
MhlI GDGCHC 2 cut(s) 120, 135
MluCI AATT 1 cut(s) 201
MmeI TCCRAC 1 cut(s) 21
MnlI CCTC 5 cut(s) 51, 88, 183, 189, 331
MseI TTAA 2 cut(s) 176, 391
MslI CAYNNNNRTG 1 cut(s) 53
MspI CCGG 1 cut(s) 86
NlaIII CATG 1 cut(s) 299
NlaIV GGNNCC 1 cut(s) 117
NspI RCATGY 1 cut(s) 299
PciI ACATGT 1 cut(s) 295
PfeI GAWTC 4 cut(s) 70, 100, 332, 361
Pfl23II CGTACG 1 cut(s) 365
PflMI CCANNNNNTGG 1 cut(s) 40
PkrI GCNGC 1 cut(s) 385
PscI ACATGT 1 cut(s) 295
Psp124BI GAGCTC 1 cut(s) 135
Psp1406I AACGTT 1 cut(s) 38
PspLI CGTACG 1 cut(s) 365
PspN4I GGNNCC 1 cut(s) 117
RsaI GTAC 2 cut(s) 294, 367
RsaNI GTAC 2 cut(s) 293, 366
RseI CAYNNNNRTG 1 cut(s) 53
SacI GAGCTC 1 cut(s) 135
SalI GTCGAC 1 cut(s) 79
SaqAI TTAA 2 cut(s) 176, 391
SatI GCNGC 1 cut(s) 384
SduI GDGCHC 2 cut(s) 120, 135
SetI ASST 9 cut(s) 41, 135, 186, 235, 245, 291, 351, 371, 388
SmiMI CAYNNNNRTG 1 cut(s) 53
Sse9I AATT 1 cut(s) 201
SsiI CCGC 3 cut(s) 15, 159, 172
SspI AATATT 1 cut(s) 21
SstI GAGCTC 1 cut(s) 135
TaaI ACNGT 2 cut(s) 9, 280
TaiI ACGT 2 cut(s) 41, 371
TaqI TCGA 2 cut(s) 80, 144
TasI AATT 1 cut(s) 201
TatI WGTACW 1 cut(s) 292
TfiI GAWTC 4 cut(s) 70, 100, 332, 361
Tru1I TTAA 2 cut(s) 176, 391
Tru9I TTAA 2 cut(s) 176, 391
TseI GCWGC 1 cut(s) 383
TspDTI ATGAA 3 cut(s) 237, 238, 242
TspGWI ACGGA 1 cut(s) 325
Van91I CCANNNNNTGG 1 cut(s) 40
XceI RCATGY 1 cut(s) 299
XmiI GTMKAC 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.