MD00G1139400.v1.1

Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates to a subcomplex that specifically deubiquitinates histones. The SAGA complex is recruited to specific gene promoters by activators, where it is required for transcription. The TREX-2 complex functions in docking export-competent ribonucleoprotein particles (mRNPs) to the nuclear entrance of the nuclear pore complex (nuclear basket). TREX-2 participates in mRNA export and accurate chromatin positioning in the nucleus by tethering genes to the nuclear periphery

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0015292
Physical Location & Seq
Reverse (-)
30067942 .. 30070389
2448 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1139400.v1.1.491

Sequence Viewer

Length: 309 bp
ATGCTGCAGAAAATCAAGCAAAAGAGCCCACCCTTCAAGAGCTTATCAGCATCGAGGTGTAGTTTGATTGAGAGCGGTGAAAAGGAGAGGTTAATGGAGCTTCTGAGGGAAAGGCTGATAGAGTGTGGATGGAAGGATGAAATGAAAGCTCTTTGCAGGGCGTTTATAAAGAAAAAGGGGAGGAACAATGTTACAGTTGATGACCTTGTACATGTAATCACCCCAAAGGGCAGAGCCTCCGTCCCCGATTCCGTGAAGGCGGAGCTTTTGCAAAGAATTCGTGCATTTCTCATGTCAGCAGCTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EnY2

Protein Analysis

103

Amino Acids

11.58

Weight (kDa)

9.89

Isoelectric Point (pI)

46.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EnY2 PF10163 21 - 97 1.6e-31 Transcription factor e(y)2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015292)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27100 AT3G27100
fragaria_vesca FvH4_6g53480 FvH4_6g53480
malus_domestica MD00G1139400.v1.1 MD09G1011100.v1.1
prunus_persica Prupe.3G305900_v2.0.a1 Prupe.3G305900_v2.0.a1
pyrus_communis pycom111g00940
rosa_chinensis RchiOBHm_Chr2g0175521
rosa_laevigata RLG00000022335
rosa_multiflora Rmu_sc0021955.1_g000007
rosa_roxburghii Rroxscaffold_2G00077240
rosa_rugosa Rorug02G0585800
rosa_samantha Rh2CG639000
rosa_wichuraiana Rw2G054510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 167
AccBSI CCGCTC 1 cut(s) 75
AciI CCGC 2 cut(s) 75, 260
AcsI RAATTY 1 cut(s) 276
AfaI GTAC 1 cut(s) 210
AflIII ACRYGT 1 cut(s) 211
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 5 cut(s) 42, 100, 149, 265, 302
AluI AGCT 5 cut(s) 42, 100, 149, 265, 302
ApeKI GCWGC 2 cut(s) 4, 299
ApoI RAATTY 1 cut(s) 276
AsuHPI GGTGA 2 cut(s) 89, 211
BanII GRGCYC 1 cut(s) 29
BccI CCATC 1 cut(s) 123
BcgI CGANNNNNNTGC 2 cut(s) 260, 294
BfmI CTRYAG 1 cut(s) 5
BisI GCNGC 2 cut(s) 5, 300
BlsI GCNGC 2 cut(s) 6, 301
BmsI GCATC 1 cut(s) 59
BseGI GGATG 2 cut(s) 134, 142
BseMII CTCAG 1 cut(s) 95
BslFI GGGAC 1 cut(s) 227
BsmFI GGGAC 1 cut(s) 227
Bsp1286I GDGCHC 1 cut(s) 29
Bsp1407I TGTACA 1 cut(s) 208
BspACI CCGC 2 cut(s) 75, 260
BspCNI CTCAG 1 cut(s) 96
BspMAI CTGCAG 1 cut(s) 9
BsrBI CCGCTC 1 cut(s) 75
BsrGI TGTACA 1 cut(s) 208
Bst4CI ACNGT 1 cut(s) 196
BstAUI TGTACA 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 104
BstF5I GGATG 2 cut(s) 134, 142
BstNSI RCATGY 1 cut(s) 215
BstSFI CTRYAG 1 cut(s) 5
BtsCI GGATG 2 cut(s) 134, 142
Csp6I GTAC 1 cut(s) 209
CviAII CATG 2 cut(s) 212, 292
CviJI RGCY 8 cut(s) 27, 42, 100, 115, 149, 236, 265, 302
CviKI_1 RGCY 8 cut(s) 27, 42, 100, 115, 149, 236, 265, 302
CviQI GTAC 1 cut(s) 209
DdeI CTNAG 1 cut(s) 104
EciI GGCGGA 1 cut(s) 275
Eco24I GRGCYC 1 cut(s) 29
EcoRI GAATTC 1 cut(s) 276
EcoT38I GRGCYC 1 cut(s) 29
FaeI CATG 2 cut(s) 215, 295
FaiI YATR 3 cut(s) 167, 213, 293
FaqI GGGAC 1 cut(s) 227
FatI CATG 2 cut(s) 211, 291
Fnu4HI GCNGC 2 cut(s) 5, 300
FokI GGATG 2 cut(s) 141, 149
FriOI GRGCYC 1 cut(s) 29
Fsp4HI GCNGC 2 cut(s) 5, 300
GluI GCNGC 2 cut(s) 5, 300
Hin1II CATG 2 cut(s) 215, 295
HinfI GANTC 1 cut(s) 248
HphI GGTGA 2 cut(s) 89, 211
Hpy188I TCNGA 1 cut(s) 105
Hpy188III TCNNGA 1 cut(s) 37
HpyAV CCTTC 3 cut(s) 43, 127, 250
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4V TGCA 4 cut(s) 7, 156, 271, 284
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 2 cut(s) 215, 295
LmnI GCTCC 2 cut(s) 97, 262
LpnPI CCDG 1 cut(s) 142
LweI GCATC 1 cut(s) 59
MaeIII GTNAC 1 cut(s) 190
MbiI CCGCTC 1 cut(s) 75
MhlI GDGCHC 1 cut(s) 29
MluCI AATT 1 cut(s) 276
MnlI CCTC 5 cut(s) 48, 81, 99, 174, 247
MseI TTAA 1 cut(s) 92
MslI CAYNNNNRTG 1 cut(s) 55
NlaIII CATG 2 cut(s) 215, 295
NspI RCATGY 1 cut(s) 215
PciI ACATGT 1 cut(s) 211
PfeI GAWTC 1 cut(s) 248
PkrI GCNGC 2 cut(s) 6, 301
PscI ACATGT 1 cut(s) 211
PsiI TTATAA 1 cut(s) 167
PstI CTGCAG 1 cut(s) 9
RsaI GTAC 1 cut(s) 210
RsaNI GTAC 1 cut(s) 209
RseI CAYNNNNRTG 1 cut(s) 55
SaqAI TTAA 1 cut(s) 92
SatI GCNGC 2 cut(s) 5, 300
SduI GDGCHC 1 cut(s) 29
SetI ASST 8 cut(s) 44, 59, 92, 102, 151, 207, 267, 304
SfaNI GCATC 1 cut(s) 59
SfcI CTRYAG 1 cut(s) 5
SmiMI CAYNNNNRTG 1 cut(s) 55
Sse9I AATT 1 cut(s) 276
SsiI CCGC 2 cut(s) 75, 260
TaaI ACNGT 1 cut(s) 196
TaqI TCGA 1 cut(s) 53
TasI AATT 1 cut(s) 276
TatI WGTACW 1 cut(s) 208
TfiI GAWTC 1 cut(s) 248
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TseI GCWGC 2 cut(s) 4, 299
TspDTI ATGAA 2 cut(s) 153, 158
TspGWI ACGGA 2 cut(s) 229, 241
XapI RAATTY 1 cut(s) 276
XceI RCATGY 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.