Prupe.3G305900_v2.0.a1

Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates to a subcomplex that specifically deubiquitinates histones. The SAGA complex is recruited to specific gene promoters by activators, where it is required for transcription. The TREX-2 complex functions in docking export-competent ribonucleoprotein particles (mRNPs) to the nuclear entrance of the nuclear pore complex (nuclear basket). TREX-2 participates in mRNA export and accurate chromatin positioning in the nucleus by tethering genes to the nuclear periphery

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Forward (+)
26776221 .. 26779470
3250 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G305900.2

Sequence Viewer

Length: 336 bp
ATGAGGAAATCGGTGAATCGTCCGCCGACGCCGGATGTTATGGAGAATCAAGGAAAAGAGCCCACTTTTCAAGAGCTTATCAACATCGAGTTGATTGAGAGCGGTGAAAAAGAGAGATTAATGGAGCTTCTGAGGGAAAGGCTAATAGAATGTGGGTGGAAGGATGAAATGAAAGCTCTTTGCAGGGCGTTTATAAAGAAAAAAGGGAGGAACAATGTTACTGTGGATGACCTTGTACATGTAATCACCCCAAAGGGCAGAGCCTCCATTCCCGATTCCATAAAGGCTGAGCTTTTGCAAAGAATTCGCACGTTTCTCGTATCAGCAGCTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.74

Weight (kDa)

9.03

Isoelectric Point (pI)

39.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015292)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27100 AT3G27100
fragaria_vesca FvH4_6g53480 FvH4_6g53480
malus_domestica MD00G1139400.v1.1 MD09G1011100.v1.1
prunus_persica Prupe.3G305900_v2.0.a1 Prupe.3G305900_v2.0.a1
pyrus_communis pycom111g00940
rosa_chinensis RchiOBHm_Chr2g0175521
rosa_laevigata RLG00000022335
rosa_multiflora Rmu_sc0021955.1_g000007
rosa_roxburghii Rroxscaffold_2G00077240
rosa_rugosa Rorug02G0585800
rosa_samantha Rh2CG639000
rosa_wichuraiana Rw2G054510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 194
AccBSI CCGCTC 1 cut(s) 102
AciI CCGC 2 cut(s) 23, 102
AcsI RAATTY 1 cut(s) 303
AcyI GRCGYC 1 cut(s) 29
AfaI GTAC 1 cut(s) 237
AflIII ACRYGT 1 cut(s) 238
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 5 cut(s) 76, 127, 176, 292, 329
AluI AGCT 5 cut(s) 76, 127, 176, 292, 329
ApeKI GCWGC 1 cut(s) 326
ApoI RAATTY 1 cut(s) 303
AseI ATTAAT 1 cut(s) 119
AsuHPI GGTGA 3 cut(s) 25, 116, 238
BanII GRGCYC 1 cut(s) 63
BcgI CGANNNNNNTGC 4 cut(s) 287, 298, 321, 332
BisI GCNGC 1 cut(s) 327
BlpI GCTNAGC 1 cut(s) 288
BlsI GCNGC 1 cut(s) 328
Bpu1102I GCTNAGC 1 cut(s) 288
BsaHI GRCGYC 1 cut(s) 29
BseGI GGATG 3 cut(s) 40, 169, 232
BseMII CTCAG 2 cut(s) 122, 279
BsiSI CCGG 1 cut(s) 32
Bsp1286I GDGCHC 1 cut(s) 63
Bsp1407I TGTACA 1 cut(s) 235
Bsp1720I GCTNAGC 1 cut(s) 288
BspACI CCGC 2 cut(s) 23, 102
BspCNI CTCAG 2 cut(s) 123, 280
BsrBI CCGCTC 1 cut(s) 102
BsrGI TGTACA 1 cut(s) 235
BssNI GRCGYC 1 cut(s) 29
Bst4CI ACNGT 1 cut(s) 223
BstACI GRCGYC 1 cut(s) 29
BstAUI TGTACA 1 cut(s) 235
BstDEI CTNAG 2 cut(s) 131, 288
BstF5I GGATG 3 cut(s) 40, 169, 232
BstNSI RCATGY 1 cut(s) 242
BtsCI GGATG 3 cut(s) 40, 169, 232
CseI GACGC 1 cut(s) 37
Csp6I GTAC 1 cut(s) 236
CviAII CATG 1 cut(s) 239
CviJI RGCY 9 cut(s) 61, 76, 127, 142, 176, 263, 287, 292, 329
CviKI_1 RGCY 9 cut(s) 61, 76, 127, 142, 176, 263, 287, 292, 329
CviQI GTAC 1 cut(s) 236
DdeI CTNAG 2 cut(s) 131, 288
EciI GGCGGA 1 cut(s) 12
Eco24I GRGCYC 1 cut(s) 63
EcoRI GAATTC 1 cut(s) 303
EcoT38I GRGCYC 1 cut(s) 63
FaeI CATG 1 cut(s) 242
FaiI YATR 4 cut(s) 41, 194, 240, 281
FatI CATG 1 cut(s) 238
Fnu4HI GCNGC 1 cut(s) 327
FokI GGATG 3 cut(s) 47, 176, 239
FriOI GRGCYC 1 cut(s) 63
Fsp4HI GCNGC 1 cut(s) 327
GluI GCNGC 1 cut(s) 327
HapII CCGG 1 cut(s) 32
HgaI GACGC 1 cut(s) 37
Hin1I GRCGYC 1 cut(s) 29
Hin1II CATG 1 cut(s) 242
HinfI GANTC 3 cut(s) 16, 46, 275
HpaII CCGG 1 cut(s) 32
HphI GGTGA 3 cut(s) 25, 116, 238
Hpy188I TCNGA 1 cut(s) 132
Hpy188III TCNNGA 2 cut(s) 71, 272
Hpy99I CGWCG 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 223
HpyCH4IV ACGT 1 cut(s) 311
HpyCH4V TGCA 2 cut(s) 183, 298
HpyF3I CTNAG 2 cut(s) 131, 288
HpySE526I ACGT 1 cut(s) 311
Hsp92I GRCGYC 1 cut(s) 29
Hsp92II CATG 1 cut(s) 242
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 2 cut(s) 45, 169
MaeII ACGT 1 cut(s) 311
MaeIII GTNAC 1 cut(s) 217
MbiI CCGCTC 1 cut(s) 102
MhlI GDGCHC 1 cut(s) 63
MluCI AATT 1 cut(s) 303
MnlI CCTC 3 cut(s) 126, 201, 274
MseI TTAA 1 cut(s) 119
MspI CCGG 1 cut(s) 32
NlaIII CATG 1 cut(s) 242
NspI RCATGY 1 cut(s) 242
PciI ACATGT 1 cut(s) 238
PfeI GAWTC 3 cut(s) 16, 46, 275
PkrI GCNGC 1 cut(s) 328
PscI ACATGT 1 cut(s) 238
PshBI ATTAAT 1 cut(s) 119
PsiI TTATAA 1 cut(s) 194
RsaI GTAC 1 cut(s) 237
RsaNI GTAC 1 cut(s) 236
SaqAI TTAA 1 cut(s) 119
SatI GCNGC 1 cut(s) 327
SduI GDGCHC 1 cut(s) 63
SetI ASST 7 cut(s) 78, 129, 178, 234, 294, 314, 331
Sse9I AATT 1 cut(s) 303
SsiI CCGC 2 cut(s) 23, 102
TaaI ACNGT 1 cut(s) 223
TaiI ACGT 1 cut(s) 314
TaqI TCGA 1 cut(s) 87
TasI AATT 1 cut(s) 303
TatI WGTACW 1 cut(s) 235
TfiI GAWTC 3 cut(s) 16, 46, 275
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TseI GCWGC 1 cut(s) 326
TspDTI ATGAA 2 cut(s) 180, 185
VspI ATTAAT 1 cut(s) 119
XapI RAATTY 1 cut(s) 303
XceI RCATGY 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.