FvH4_6g53480

Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates to a subcomplex that specifically deubiquitinates histones. The SAGA complex is recruited to specific gene promoters by activators, where it is required for transcription. The TREX-2 complex functions in docking export-competent ribonucleoprotein particles (mRNPs) to the nuclear entrance of the nuclear pore complex (nuclear basket). TREX-2 participates in mRNA export and accurate chromatin positioning in the nucleus by tethering genes to the nuclear periphery

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0015292
Physical Location & Seq
Forward (+)
39196907 .. 39199864
2958 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g53480.t1

Sequence Viewer

Length: 336 bp
ATGAGGAAATCGGTGAATCGTCAGCCGGCGCCGGAGGTTGAGGAGAATCAAGACAAGGAGCCCAGCTTTGAAGAGCTCATCAACATCGAGTTGATTGAGAGCGGTGAGAAAGAGCGGTTAATGGAGCTGTTGAGGGAGAGGCTGATTGAGTGTGGGTGGAAGGATGAAATGAAAGCTCTTTGCAGGTCATTCATAAAGAAAAAAGGGAGGAACAATGTTACTGTGGATGACCTTGTACATGTAATCACCCCAAAGGGCAGAGCTTCCATTCCTGATTCCATAAAGGCAGAGCTTCTGCAAAGGATTCGTACATTCCTAATCTCGGCAGCTCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EnY2

Protein Analysis

112

Amino Acids

12.83

Weight (kDa)

6.62

Isoelectric Point (pI)

55.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EnY2 PF10163 27 - 106 1.5e-31 Transcription factor e(y)2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015292)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27100 AT3G27100
fragaria_vesca FvH4_6g53480 FvH4_6g53480
malus_domestica MD00G1139400.v1.1 MD09G1011100.v1.1
prunus_persica Prupe.3G305900_v2.0.a1 Prupe.3G305900_v2.0.a1
pyrus_communis pycom111g00940
rosa_chinensis RchiOBHm_Chr2g0175521
rosa_laevigata RLG00000022335
rosa_multiflora Rmu_sc0021955.1_g000007
rosa_roxburghii Rroxscaffold_2G00077240
rosa_rugosa Rorug02G0585800
rosa_samantha Rh2CG639000
rosa_wichuraiana Rw2G054510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 174
AccB1I GGYRCC 1 cut(s) 28
AccBSI CCGCTC 2 cut(s) 102, 115
AciI CCGC 2 cut(s) 102, 115
AcyI GRCGYC 1 cut(s) 29
AfaI GTAC 2 cut(s) 237, 310
AfiI CCNNNNNNNGG 1 cut(s) 322
AflIII ACRYGT 1 cut(s) 238
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 7 cut(s) 66, 76, 127, 176, 263, 292, 329
AluI AGCT 7 cut(s) 66, 76, 127, 176, 263, 292, 329
Alw21I GWGCWC 1 cut(s) 78
ApeKI GCWGC 1 cut(s) 326
AspLEI GCGC 1 cut(s) 31
AsuHPI GGTGA 3 cut(s) 25, 116, 238
BanI GGYRCC 1 cut(s) 28
BanII GRGCYC 2 cut(s) 63, 78
Bbv12I GWGCWC 1 cut(s) 78
BcgI CGANNNNNNTGC 2 cut(s) 287, 321
BfoI RGCGCY 1 cut(s) 32
BfuAI ACCTGC 1 cut(s) 174
BisI GCNGC 1 cut(s) 327
BlsI GCNGC 1 cut(s) 328
BmiI GGNNCC 2 cut(s) 30, 60
BsaHI GRCGYC 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 322
Bse118I RCCGGY 1 cut(s) 25
BseGI GGATG 2 cut(s) 169, 232
BseLI CCNNNNNNNGG 1 cut(s) 322
BseRI GAGGAG 1 cut(s) 56
BseYI CCCAGC 1 cut(s) 62
BshNI GGYRCC 1 cut(s) 28
BsiHKAI GWGCWC 1 cut(s) 78
BsiSI CCGG 2 cut(s) 26, 32
BslI CCNNNNNNNGG 1 cut(s) 322
Bsp1286I GDGCHC 2 cut(s) 63, 78
Bsp1407I TGTACA 1 cut(s) 235
BspACI CCGC 2 cut(s) 102, 115
BspLI GGNNCC 2 cut(s) 30, 60
BspMI ACCTGC 1 cut(s) 174
BspQI GCTCTTC 1 cut(s) 66
BspT107I GGYRCC 1 cut(s) 28
BsrBI CCGCTC 2 cut(s) 102, 115
BsrFI RCCGGY 1 cut(s) 25
BsrGI TGTACA 1 cut(s) 235
BssAI RCCGGY 1 cut(s) 25
BssNI GRCGYC 1 cut(s) 29
Bst4CI ACNGT 1 cut(s) 223
Bst6I CTCTTC 1 cut(s) 66
BstACI GRCGYC 1 cut(s) 29
BstAUI TGTACA 1 cut(s) 235
BstC8I GCNNGC 1 cut(s) 27
BstF5I GGATG 2 cut(s) 169, 232
BstH2I RGCGCY 1 cut(s) 32
BstHHI GCGC 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 242
BtsCI GGATG 2 cut(s) 169, 232
BveI ACCTGC 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 27
CfoI GCGC 1 cut(s) 31
Cfr10I RCCGGY 1 cut(s) 25
Csp6I GTAC 2 cut(s) 236, 309
CviAII CATG 1 cut(s) 239
CviQI GTAC 2 cut(s) 236, 309
DinI GGCGCC 1 cut(s) 30
Eam1104I CTCTTC 1 cut(s) 66
EarI CTCTTC 1 cut(s) 66
Ecl136II GAGCTC 1 cut(s) 76
Eco24I GRGCYC 2 cut(s) 63, 78
Eco53kI GAGCTC 1 cut(s) 76
EcoICRI GAGCTC 1 cut(s) 76
EcoT38I GRGCYC 2 cut(s) 63, 78
EgeI GGCGCC 1 cut(s) 30
EheI GGCGCC 1 cut(s) 30
FaeI CATG 1 cut(s) 242
FaiI YATR 4 cut(s) 194, 240, 281, 334
FatI CATG 1 cut(s) 238
Fnu4HI GCNGC 1 cut(s) 327
FokI GGATG 2 cut(s) 176, 239
FriOI GRGCYC 2 cut(s) 63, 78
Fsp4HI GCNGC 1 cut(s) 327
GlaI GCGC 1 cut(s) 30
GluI GCNGC 1 cut(s) 327
GsaI CCCAGC 1 cut(s) 66
HaeII RGCGCY 1 cut(s) 32
HapII CCGG 2 cut(s) 26, 32
HhaI GCGC 1 cut(s) 31
Hin1I GRCGYC 1 cut(s) 29
Hin1II CATG 1 cut(s) 242
Hin6I GCGC 1 cut(s) 29
HinP1I GCGC 1 cut(s) 29
HinfI GANTC 4 cut(s) 16, 46, 275, 304
HpaII CCGG 2 cut(s) 26, 32
HphI GGTGA 3 cut(s) 25, 116, 238
Hpy188III TCNNGA 2 cut(s) 50, 272
HpyAV CCTTC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 223
HpyCH4V TGCA 2 cut(s) 183, 298
Hsp92I GRCGYC 1 cut(s) 29
Hsp92II CATG 1 cut(s) 242
HspAI GCGC 1 cut(s) 29
KasI GGCGCC 1 cut(s) 28
KroI GCCGGC 1 cut(s) 25
KroNI GCCGGC 1 cut(s) 27
LguI GCTCTTC 1 cut(s) 66
LmnI GCTCC 2 cut(s) 58, 124
LpnPI CCDG 5 cut(s) 39, 45, 76, 169, 285
MaeIII GTNAC 1 cut(s) 217
MbiI CCGCTC 2 cut(s) 102, 115
MboII GAAGA 1 cut(s) 83
MhlI GDGCHC 2 cut(s) 63, 78
Mly113I GGCGCC 1 cut(s) 29
MnlI CCTC 5 cut(s) 28, 34, 126, 132, 201
MroNI GCCGGC 1 cut(s) 25
MseI TTAA 1 cut(s) 119
MspI CCGG 2 cut(s) 26, 32
NaeI GCCGGC 1 cut(s) 27
NarI GGCGCC 1 cut(s) 29
NgoMIV GCCGGC 1 cut(s) 25
NlaIII CATG 1 cut(s) 242
NlaIV GGNNCC 2 cut(s) 30, 60
NmeAIII GCCGAG 1 cut(s) 302
NspI RCATGY 1 cut(s) 242
PciI ACATGT 1 cut(s) 238
PciSI GCTCTTC 1 cut(s) 66
PdiI GCCGGC 1 cut(s) 27
PfeI GAWTC 4 cut(s) 16, 46, 275, 304
PkrI GCNGC 1 cut(s) 328
PluTI GGCGCC 1 cut(s) 32
PscI ACATGT 1 cut(s) 238
Psp124BI GAGCTC 1 cut(s) 78
PspFI CCCAGC 1 cut(s) 62
PspN4I GGNNCC 2 cut(s) 30, 60
RsaI GTAC 2 cut(s) 237, 310
RsaNI GTAC 2 cut(s) 236, 309
SacI GAGCTC 1 cut(s) 78
SapI GCTCTTC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 119
SatI GCNGC 1 cut(s) 327
SduI GDGCHC 2 cut(s) 63, 78
SfoI GGCGCC 1 cut(s) 30
SsiI CCGC 2 cut(s) 102, 115
SspDI GGCGCC 1 cut(s) 28
SstI GAGCTC 1 cut(s) 78
TaaI ACNGT 1 cut(s) 223
TaqI TCGA 1 cut(s) 87
TatI WGTACW 1 cut(s) 235
TfiI GAWTC 4 cut(s) 16, 46, 275, 304
Tru1I TTAA 1 cut(s) 119
Tru9I TTAA 1 cut(s) 119
TseI GCWGC 1 cut(s) 326
TspDTI ATGAA 3 cut(s) 180, 181, 185
XceI RCATGY 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.