Rmu_sc0021955.1_g000007

Involved in mRNA export coupled transcription activation by association with both the TREX-2 and the SAGA complexes. The transcription regulatory histone acetylation (HAT) complex SAGA is a multiprotein complex that activates transcription by remodeling chromatin and mediating histone acetylation and deubiquitination. Within the SAGA complex, participates to a subcomplex that specifically deubiquitinates histones. The SAGA complex is recruited to specific gene promoters by activators, where it is required for transcription. The TREX-2 complex functions in docking export-competent ribonucleoprotein particles (mRNPs) to the nuclear entrance of the nuclear pore complex (nuclear basket). TREX-2 participates in mRNA export and accurate chromatin positioning in the nucleus by tethering genes to the nuclear periphery

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021955.1
OG0015292
Physical Location & Seq
Forward (+)
23203 .. 26110
2908 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021955.1_g000007.1.cds

Sequence Viewer

Length: 462 bp
atgttaaacaatgaaggggtggtttttggttcagcccaagtgagcacgtcaaattttaaagaccaggttgggctcggtggtagagacgctgcaaatttctcagtccccgatagactaaaaaccatgaggaaatcggtgaatcgtcagtcgacgccggatgttgaggagaatcaagaagacaaggagcccagtttccaagagctcataaacatcgagttgattgagagcggtgaaaaggagcggttaatggagctactgagggagaggctaattgagtgtgggtggaaggatgaaatgaaagctctttgcaggtcattcataaagaaaaaaggaaggaacaatgttactgtggatgaccttgtacatgtaatcaccccaaagggcagagcctccattcctgattccgtaaaggcagagctgttgcaaaggattcgtacgttcctgatgtcggcagctctttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EnY2

Protein Analysis

153

Amino Acids

17.28

Weight (kDa)

6.62

Isoelectric Point (pI)

40.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015292)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G27100 AT3G27100
fragaria_vesca FvH4_6g53480 FvH4_6g53480
malus_domestica MD00G1139400.v1.1 MD09G1011100.v1.1
prunus_persica Prupe.3G305900_v2.0.a1 Prupe.3G305900_v2.0.a1
pyrus_communis pycom111g00940
rosa_chinensis RchiOBHm_Chr2g0175521
rosa_laevigata RLG00000022335
rosa_multiflora Rmu_sc0021955.1_g000007
rosa_roxburghii Rroxscaffold_2G00077240
rosa_rugosa Rorug02G0585800
rosa_samantha Rh2CG639000
rosa_wichuraiana Rw2G054510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 300
AccBSI CCGCTC 2 cut(s) 228, 241
AccI GTMKAC 1 cut(s) 149
AciI CCGC 2 cut(s) 228, 241
AcsI RAATTY 2 cut(s) 52, 94
AcyI GRCGYC 1 cut(s) 152
AfaI GTAC 2 cut(s) 363, 436
AfiI CCNNNNNNNGG 1 cut(s) 448
AflIII ACRYGT 1 cut(s) 364
AjiI CACGTC 1 cut(s) 48
AjnI CCWGG 1 cut(s) 63
AluBI AGCT 5 cut(s) 202, 253, 302, 418, 455
AluI AGCT 5 cut(s) 202, 253, 302, 418, 455
Alw21I GWGCWC 2 cut(s) 47, 204
Alw26I GTCTC 1 cut(s) 78
ApeKI GCWGC 2 cut(s) 89, 452
ApoI RAATTY 2 cut(s) 52, 94
AsuHPI GGTGA 3 cut(s) 148, 242, 364
BanII GRGCYC 3 cut(s) 75, 189, 204
BbsI GAAGAC 1 cut(s) 183
Bbv12I GWGCWC 2 cut(s) 47, 204
BbvI GCAGC 1 cut(s) 76
BcgI CGANNNNNNTGC 2 cut(s) 413, 447
BciT130I CCWGG 1 cut(s) 65
BcoDI GTCTC 1 cut(s) 78
BfuAI ACCTGC 1 cut(s) 300
BisI GCNGC 2 cut(s) 90, 453
BlsI GCNGC 2 cut(s) 91, 454
Bme1390I CCNGG 1 cut(s) 65
BmgBI CACGTC 1 cut(s) 48
BmiI GGNNCC 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 65
BmrI ACTGGG 1 cut(s) 183
BmuI ACTGGG 1 cut(s) 183
BpiI GAAGAC 1 cut(s) 183
BsaHI GRCGYC 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 448
Bse1I ACTGG 1 cut(s) 189
BseBI CCWGG 1 cut(s) 65
BseGI GGATG 3 cut(s) 163, 295, 358
BseLI CCNNNNNNNGG 1 cut(s) 448
BseMII CTCAG 2 cut(s) 114, 248
BseNI ACTGG 1 cut(s) 189
BseRI GAGGAG 1 cut(s) 179
BseXI GCAGC 1 cut(s) 76
BsiHKAI GWGCWC 2 cut(s) 47, 204
BsiSI CCGG 1 cut(s) 155
BsiWI CGTACG 1 cut(s) 434
BslFI GGGAC 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 448
BsmAI GTCTC 1 cut(s) 78
BsmBI CGTCTC 1 cut(s) 78
BsmFI GGGAC 1 cut(s) 89
Bsp1286I GDGCHC 4 cut(s) 47, 75, 189, 204
Bsp1407I TGTACA 1 cut(s) 361
BspACI CCGC 2 cut(s) 228, 241
BspCNI CTCAG 2 cut(s) 113, 249
BspLI GGNNCC 1 cut(s) 186
BspMI ACCTGC 1 cut(s) 300
BsrBI CCGCTC 2 cut(s) 228, 241
BsrGI TGTACA 1 cut(s) 361
BsrI ACTGG 1 cut(s) 189
BssNI GRCGYC 1 cut(s) 152
Bst2UI CCWGG 1 cut(s) 65
Bst4CI ACNGT 1 cut(s) 349
BstACI GRCGYC 1 cut(s) 152
BstAUI TGTACA 1 cut(s) 361
BstDEI CTNAG 2 cut(s) 100, 257
BstF5I GGATG 3 cut(s) 163, 295, 358
BstMAI GTCTC 1 cut(s) 78
BstNI CCWGG 1 cut(s) 65
BstNSI RCATGY 1 cut(s) 368
BstSCI CCNGG 1 cut(s) 63
BstV1I GCAGC 1 cut(s) 76
BstV2I GAAGAC 1 cut(s) 183
BtrI CACGTC 1 cut(s) 48
BtsCI GGATG 3 cut(s) 163, 295, 358
BveI ACCTGC 1 cut(s) 300
CseI GACGC 2 cut(s) 95, 160
CsiI ACCWGGT 1 cut(s) 63
Csp6I GTAC 2 cut(s) 362, 435
CviAII CATG 2 cut(s) 124, 365
CviQI GTAC 2 cut(s) 362, 435
DdeI CTNAG 2 cut(s) 100, 257
DraI TTTAAA 1 cut(s) 58
Ecl136II GAGCTC 1 cut(s) 202
Eco24I GRGCYC 3 cut(s) 75, 189, 204
Eco53kI GAGCTC 1 cut(s) 202
EcoICRI GAGCTC 1 cut(s) 202
EcoRII CCWGG 1 cut(s) 63
EcoT38I GRGCYC 3 cut(s) 75, 189, 204
Esp3I CGTCTC 1 cut(s) 78
FaeI CATG 2 cut(s) 127, 368
FaiI YATR 4 cut(s) 125, 206, 320, 366
FaqI GGGAC 1 cut(s) 89
FatI CATG 2 cut(s) 123, 364
FblI GTMKAC 1 cut(s) 149
Fnu4HI GCNGC 2 cut(s) 90, 453
FokI GGATG 3 cut(s) 170, 302, 365
FriOI GRGCYC 3 cut(s) 75, 189, 204
Fsp4HI GCNGC 2 cut(s) 90, 453
GluI GCNGC 2 cut(s) 90, 453
HapII CCGG 1 cut(s) 155
HgaI GACGC 2 cut(s) 95, 160
Hin1I GRCGYC 1 cut(s) 152
Hin1II CATG 2 cut(s) 127, 368
HincII GTYRAC 1 cut(s) 150
HindII GTYRAC 1 cut(s) 150
HinfI GANTC 4 cut(s) 139, 169, 401, 430
HpaII CCGG 1 cut(s) 155
HphI GGTGA 3 cut(s) 148, 242, 364
Hpy166II GTNNAC 1 cut(s) 150
Hpy188III TCNNGA 3 cut(s) 173, 398, 442
Hpy8I GTNNAC 1 cut(s) 150
Hpy99I CGWCG 1 cut(s) 154
HpyAV CCTTC 3 cut(s) 8, 280, 327
HpyCH4III ACNGT 1 cut(s) 349
HpyCH4IV ACGT 2 cut(s) 47, 437
HpyCH4V TGCA 3 cut(s) 92, 309, 424
HpyF3I CTNAG 2 cut(s) 100, 257
HpySE526I ACGT 2 cut(s) 47, 437
Hsp92I GRCGYC 1 cut(s) 152
Hsp92II CATG 2 cut(s) 127, 368
LmnI GCTCC 3 cut(s) 184, 238, 250
LpnPI CCDG 7 cut(s) 50, 77, 168, 202, 295, 411, 455
Lsp1109I GCAGC 1 cut(s) 76
MabI ACCWGGT 1 cut(s) 63
MaeII ACGT 2 cut(s) 47, 437
MaeIII GTNAC 1 cut(s) 343
MbiI CCGCTC 2 cut(s) 228, 241
MboII GAAGA 1 cut(s) 188
MhlI GDGCHC 4 cut(s) 47, 75, 189, 204
MluCI AATT 3 cut(s) 52, 94, 270
MnlI CCTC 5 cut(s) 120, 157, 252, 258, 400
MseI TTAA 4 cut(s) 5, 57, 245, 460
MspI CCGG 1 cut(s) 155
MspR9I CCNGG 1 cut(s) 65
MvaI CCWGG 1 cut(s) 65
NlaIII CATG 2 cut(s) 127, 368
NlaIV GGNNCC 1 cut(s) 186
NspI RCATGY 1 cut(s) 368
PciI ACATGT 1 cut(s) 364
PfeI GAWTC 4 cut(s) 139, 169, 401, 430
Pfl23II CGTACG 1 cut(s) 434
PkrI GCNGC 2 cut(s) 91, 454
PscI ACATGT 1 cut(s) 364
Psp124BI GAGCTC 1 cut(s) 204
Psp6I CCWGG 1 cut(s) 63
PspGI CCWGG 1 cut(s) 63
PspLI CGTACG 1 cut(s) 434
PspN4I GGNNCC 1 cut(s) 186
RsaI GTAC 2 cut(s) 363, 436
RsaNI GTAC 2 cut(s) 362, 435
SacI GAGCTC 1 cut(s) 204
SalI GTCGAC 1 cut(s) 148
SaqAI TTAA 4 cut(s) 5, 57, 245, 460
SatI GCNGC 2 cut(s) 90, 453
ScrFI CCNGG 1 cut(s) 65
SduI GDGCHC 4 cut(s) 47, 75, 189, 204
SexAI ACCWGGT 1 cut(s) 63
Sse9I AATT 3 cut(s) 52, 94, 270
SsiI CCGC 2 cut(s) 228, 241
SstI GAGCTC 1 cut(s) 204
StyD4I CCNGG 1 cut(s) 63
TaaI ACNGT 1 cut(s) 349
TaiI ACGT 2 cut(s) 50, 440
TaqI TCGA 2 cut(s) 149, 213
TasI AATT 3 cut(s) 52, 94, 270
TatI WGTACW 1 cut(s) 361
TfiI GAWTC 4 cut(s) 139, 169, 401, 430
Tru1I TTAA 4 cut(s) 5, 57, 245, 460
Tru9I TTAA 4 cut(s) 5, 57, 245, 460
TseI GCWGC 2 cut(s) 89, 452
TspDTI ATGAA 4 cut(s) 27, 306, 307, 311
TspGWI ACGGA 1 cut(s) 394
XapI RAATTY 2 cut(s) 52, 94
XceI RCATGY 1 cut(s) 368
XmiI GTMKAC 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.