AT4G00585

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Reverse (-)
250840 .. 252598
1759 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G00585.1

Sequence Viewer

Length: 267 bp
ATGGGAGGAGGTGATCATGGACATGGAGCAGAAGGAGGCGATTTCAGAGCCAAAGTCTGGAGTATGACTGGTGGGCCTAACTGTAGGCCCAAACATTGGCGTCGGAACACCGCCATTGCTATGTTCGGCGTTTTCCTTGTGTGCATCCCCATCGCCAAGCTATCTGCTAAGCTTGAGCAAAGGCCACACATGCCAGTACGCCCAATTCCTTCACAGATCTGGTGCAAGAACTTTGGAACCAAGGACGATTACGAAAAAGAGCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.86

Weight (kDa)

9.45

Isoelectric Point (pI)

28.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 57, 96
AciI CCGC 1 cut(s) 111
AcyI GRCGYC 1 cut(s) 100
AfaI GTAC 1 cut(s) 198
AfiI CCNNNNNNNGG 2 cut(s) 57, 96
AluBI AGCT 2 cut(s) 160, 172
AluI AGCT 2 cut(s) 160, 172
AoxI GGCC 3 cut(s) 74, 86, 182
AspS9I GGNCC 2 cut(s) 74, 87
AsuHPI GGTGA 1 cut(s) 23
BccI CCATC 1 cut(s) 158
BcgI CGANNNNNNTGC 2 cut(s) 133, 167
BclI TGATCA 1 cut(s) 13
BfmI CTRYAG 1 cut(s) 82
BglII AGATCT 1 cut(s) 216
BlpI GCTNAGC 1 cut(s) 168
BmgT120I GGNCC 2 cut(s) 74, 87
BmiI GGNNCC 1 cut(s) 238
BmsI GCATC 1 cut(s) 153
BpmI CTGGAG 1 cut(s) 79
Bpu1102I GCTNAGC 1 cut(s) 168
BpuEI CTTGAG 1 cut(s) 194
BsaHI GRCGYC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 240
Bsc4I CCNNNNNNNGG 2 cut(s) 57, 96
Bse1I ACTGG 2 cut(s) 73, 194
Bse3DI GCAATG 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 240
BseGI GGATG 1 cut(s) 144
BseLI CCNNNNNNNGG 2 cut(s) 57, 96
BseMI GCAATG 1 cut(s) 114
BseNI ACTGG 2 cut(s) 73, 194
BseRI GAGGAG 1 cut(s) 21
BshFI GGCC 3 cut(s) 76, 88, 184
BslI CCNNNNNNNGG 2 cut(s) 57, 96
BsnI GGCC 3 cut(s) 76, 88, 184
Bsp143I GATC 2 cut(s) 13, 216
Bsp1720I GCTNAGC 1 cut(s) 168
BspACI CCGC 1 cut(s) 111
BspANI GGCC 3 cut(s) 76, 88, 184
BspLI GGNNCC 1 cut(s) 238
BsrDI GCAATG 1 cut(s) 114
BsrI ACTGG 2 cut(s) 73, 194
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 2 cut(s) 13, 216
BssNI GRCGYC 1 cut(s) 100
BssT1I CCWWGG 1 cut(s) 240
Bst4CI ACNGT 1 cut(s) 83
BstACI GRCGYC 1 cut(s) 100
BstDEI CTNAG 1 cut(s) 168
BstF5I GGATG 1 cut(s) 144
BstKTI GATC 2 cut(s) 16, 219
BstMBI GATC 2 cut(s) 13, 216
BstMWI GCNNNNNNNGC 1 cut(s) 190
BstNSI RCATGY 1 cut(s) 193
BstSFI CTRYAG 1 cut(s) 82
BstX2I RGATCY 1 cut(s) 216
BstYI RGATCY 1 cut(s) 216
BsuRI GGCC 3 cut(s) 76, 88, 184
BtgZI GCGATG 1 cut(s) 136
BtsCI GGATG 1 cut(s) 144
Cfr13I GGNCC 2 cut(s) 74, 87
CseI GACGC 1 cut(s) 89
Csp6I GTAC 1 cut(s) 197
CviAII CATG 3 cut(s) 17, 23, 190
CviJI RGCY 6 cut(s) 50, 76, 88, 160, 172, 184
CviKI_1 RGCY 6 cut(s) 50, 76, 88, 160, 172, 184
CviQI GTAC 1 cut(s) 197
DdeI CTNAG 1 cut(s) 168
DpnI GATC 2 cut(s) 15, 218
DpnII GATC 2 cut(s) 13, 216
Eco130I CCWWGG 1 cut(s) 240
EcoT14I CCWWGG 1 cut(s) 240
ErhI CCWWGG 1 cut(s) 240
FaeI CATG 3 cut(s) 20, 26, 193
FaiI YATR 5 cut(s) 18, 24, 65, 122, 191
FatI CATG 3 cut(s) 16, 22, 189
FbaI TGATCA 1 cut(s) 13
FokI GGATG 1 cut(s) 131
GsuI CTGGAG 1 cut(s) 79
HaeIII GGCC 3 cut(s) 76, 88, 184
HgaI GACGC 1 cut(s) 89
Hin1I GRCGYC 1 cut(s) 100
Hin1II CATG 3 cut(s) 20, 26, 193
HindIII AAGCTT 1 cut(s) 170
HphI GGTGA 1 cut(s) 23
Hpy188I TCNGA 2 cut(s) 47, 105
Hpy188III TCNNGA 1 cut(s) 58
Hpy99I CGWCG 1 cut(s) 105
HpyAV CCTTC 2 cut(s) 26, 219
HpyCH4III ACNGT 1 cut(s) 83
HpyCH4V TGCA 2 cut(s) 144, 225
HpyF10VI GCNNNNNNNGC 1 cut(s) 190
HpyF3I CTNAG 1 cut(s) 168
Hsp92I GRCGYC 1 cut(s) 100
Hsp92II CATG 3 cut(s) 20, 26, 193
Ksp22I TGATCA 1 cut(s) 13
Kzo9I GATC 2 cut(s) 13, 216
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 4 cut(s) 43, 54, 205, 207
LweI GCATC 1 cut(s) 153
MalI GATC 2 cut(s) 15, 218
MboI GATC 2 cut(s) 13, 216
MflI RGATCY 1 cut(s) 216
MluCI AATT 1 cut(s) 204
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 1 cut(s) 29
MseI TTAA 1 cut(s) 265
MslI CAYNNNNRTG 2 cut(s) 21, 119
MwoI GCNNNNNNNGC 1 cut(s) 190
NdeII GATC 2 cut(s) 13, 216
NlaIII CATG 3 cut(s) 20, 26, 193
NlaIV GGNNCC 1 cut(s) 238
NspI RCATGY 1 cut(s) 193
PflMI CCANNNNNTGG 2 cut(s) 57, 96
PspN4I GGNNCC 1 cut(s) 238
PspPI GGNCC 2 cut(s) 74, 87
PsuI RGATCY 1 cut(s) 216
RsaI GTAC 1 cut(s) 198
RsaNI GTAC 1 cut(s) 197
RseI CAYNNNNRTG 2 cut(s) 21, 119
SaqAI TTAA 1 cut(s) 265
Sau3AI GATC 2 cut(s) 13, 216
Sau96I GGNCC 2 cut(s) 74, 87
SetI ASST 3 cut(s) 13, 162, 174
SfaNI GCATC 1 cut(s) 153
SfcI CTRYAG 1 cut(s) 82
SmiMI CAYNNNNRTG 2 cut(s) 21, 119
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 1 cut(s) 204
SsiI CCGC 1 cut(s) 111
StyI CCWWGG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 83
TasI AATT 1 cut(s) 204
Tru1I TTAA 1 cut(s) 265
Tru9I TTAA 1 cut(s) 265
Van91I CCANNNNNTGG 2 cut(s) 57, 96
XceI RCATGY 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.