Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001207.1

Orthogroup ID

OG0011874

Physical Location & Seq

Genomic Coordinates Reverse (-)

310006 .. 310254

Gene Structure 249 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001207.1_g000076.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

atgggaggaggcgagcatgcgcacggcgaaggggcccacggcggagacttcagggcgaaggtgtggagcatgagcggtgggccctactgcaggcccaagcactggaagcgcaacacggccttcgccatgttcggagtcttcctcatctgcattcccatcgccatgaaatctgccgagctcgaggttcgttcacttcacctcagttcatctcctttctcttttggtttcgactttggatttctgttttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

82

Amino Acids

9.01

Weight (kDa)

8.77

Isoelectric Point (pI)

35.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011874)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G00585
malus_domestica	MD01G1052300.v1.1
prunus_persica	Prupe.2G159900_v2.0.a1 Prupe.2G159900_v2.0.a1 Prupe.2G159900_v2.0.a1
pyrus_communis	pycom07g12460
rosa_chinensis	RchiOBHm_Chr0c39g0503241 RchiOBHm_Chr1g0353201 RchiOBHm_Chr1g0353351 RchiOBHm_Chr1g0353371
rosa_multiflora	Rmu_sc0001207.1_g000014 Rmu_sc0001207.1_g000076 Rmu_sc0011028.1_g000010
rosa_roxburghii	Rroxscaffold_4G00301890
rosa_rugosa	Rorug01G0235500
rosa_samantha	Rh1AG247700 Rh1CG231400
rosa_wichuraiana	Rw0G018060 Rw1G021580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	21
AccB7I	CCANNNNNTGG	1 cut(s)	102
AccBSI	CCGCTC	1 cut(s)	75
AciI	CCGC	2 cut(s)	42, 75
AcuI	CTGAAG	1 cut(s)	34
AfiI	CCNNNNNNNGG	2 cut(s)	90, 102
AluBI	AGCT	1 cut(s)	178
AluI	AGCT	1 cut(s)	178
Alw21I	GWGCWC	1 cut(s)	180
Alw26I	GTCTC	1 cut(s)	39
Ama87I	CYCGRG	1 cut(s)	179
AoxI	GGCC	4 cut(s)	33, 80, 92, 117
ApaI	GGGCCC	2 cut(s)	37, 84
AspLEI	GCGC	2 cut(s)	22, 111
AspS9I	GGNCC	5 cut(s)	33, 34, 80, 81, 93
AsuHPI	GGTGA	1 cut(s)	188
AvaI	CYCGRG	1 cut(s)	179
BaeGI	GKGCMC	2 cut(s)	37, 84
BanII	GRGCYC	3 cut(s)	37, 84, 180
BbsI	GAAGAC	1 cut(s)	130
Bbv12I	GWGCWC	1 cut(s)	180
BccI	CCATC	1 cut(s)	164
BceAI	ACGGC	3 cut(s)	40, 55, 132
BcgI	CGANNNNNNTGC	2 cut(s)	139, 173
BcoDI	GTCTC	1 cut(s)	39
BfmI	CTRYAG	1 cut(s)	88
BmeT110I	CYCGRG	1 cut(s)	179
BmgT120I	GGNCC	5 cut(s)	33, 34, 80, 81, 93
BmiI	GGNNCC	3 cut(s)	34, 35, 82
BpiI	GAAGAC	1 cut(s)	130
BplI	GAGNNNNNCTC	2 cut(s)	126, 158
BsaJI	CCNNGG	1 cut(s)	37
Bsc4I	CCNNNNNNNGG	2 cut(s)	90, 102
Bse1I	ACTGG	1 cut(s)	107
BseDI	CCNNGG	1 cut(s)	37
BseLI	CCNNNNNNNGG	2 cut(s)	90, 102
BseMII	CTCAG	1 cut(s)	214
BseNI	ACTGG	1 cut(s)	107
BseRI	GAGGAG	1 cut(s)	21
BseSI	GKGCMC	2 cut(s)	37, 84
BshFI	GGCC	4 cut(s)	35, 82, 94, 119
BsiHKAI	GWGCWC	1 cut(s)	180
BsiHKCI	CYCGRG	1 cut(s)	179
BslI	CCNNNNNNNGG	2 cut(s)	90, 102
BsmAI	GTCTC	1 cut(s)	39
BsmI	GAATGC	1 cut(s)	150
BsnI	GGCC	4 cut(s)	35, 82, 94, 119
BsoBI	CYCGRG	1 cut(s)	179
Bsp120I	GGGCCC	2 cut(s)	33, 80
Bsp1286I	GDGCHC	3 cut(s)	37, 84, 180
BspACI	CCGC	2 cut(s)	42, 75
BspANI	GGCC	4 cut(s)	35, 82, 94, 119
BspCNI	CTCAG	1 cut(s)	213
BspLI	GGNNCC	3 cut(s)	34, 35, 82
BspMAI	CTGCAG	1 cut(s)	92
BsrBI	CCGCTC	1 cut(s)	75
BsrI	ACTGG	1 cut(s)	107
BssECI	CCNNGG	1 cut(s)	37
BstC8I	GCNNGC	3 cut(s)	14, 18, 92
BstDEI	CTNAG	1 cut(s)	200
BstDSI	CCRYGG	1 cut(s)	37
BstENI	CCTNNNNNAGG	1 cut(s)	88
BstHHI	GCGC	2 cut(s)	22, 111
BstMAI	GTCTC	1 cut(s)	39
BstMWI	GCNNNNNNNGC	1 cut(s)	106
BstNSI	RCATGY	1 cut(s)	20
BstSFI	CTRYAG	1 cut(s)	88
BstSLI	GKGCMC	2 cut(s)	37, 84
BstV2I	GAAGAC	1 cut(s)	130
BsuRI	GGCC	4 cut(s)	35, 82, 94, 119
BtgI	CCRYGG	1 cut(s)	37
BtgZI	GCGATG	1 cut(s)	142
BtsIMutI	CAGTG	1 cut(s)	100
Cac8I	GCNNGC	3 cut(s)	14, 18, 92
CfoI	GCGC	2 cut(s)	22, 111
Cfr13I	GGNCC	5 cut(s)	33, 34, 80, 81, 93
CviAII	CATG	4 cut(s)	17, 70, 127, 163
CviJI	RGCY	5 cut(s)	35, 82, 94, 119, 178
CviKI_1	RGCY	5 cut(s)	35, 82, 94, 119, 178
DdeI	CTNAG	1 cut(s)	200
EciI	GGCGGA	1 cut(s)	57
Ecl136II	GAGCTC	1 cut(s)	178
Eco24I	GRGCYC	3 cut(s)	37, 84, 180
Eco53kI	GAGCTC	1 cut(s)	178
Eco57I	CTGAAG	1 cut(s)	34
Eco88I	CYCGRG	1 cut(s)	179
EcoICRI	GAGCTC	1 cut(s)	178
EcoNI	CCTNNNNNAGG	1 cut(s)	88
EcoO109I	RGGNCCY	2 cut(s)	33, 81
EcoT38I	GRGCYC	3 cut(s)	37, 84, 180
FaeI	CATG	4 cut(s)	20, 73, 130, 166
FaiI	YATR	4 cut(s)	18, 71, 128, 164
FatI	CATG	4 cut(s)	16, 69, 126, 162
FriOI	GRGCYC	3 cut(s)	37, 84, 180
FspAI	RTGCGCAY	1 cut(s)	21
FspI	TGCGCA	1 cut(s)	21
GlaI	GCGC	2 cut(s)	21, 110
HaeIII	GGCC	4 cut(s)	35, 82, 94, 119
HhaI	GCGC	2 cut(s)	22, 111
Hin1II	CATG	4 cut(s)	20, 73, 130, 166
Hin6I	GCGC	2 cut(s)	20, 109
HinP1I	GCGC	2 cut(s)	20, 109
HinfI	GANTC	1 cut(s)	135
HphI	GGTGA	1 cut(s)	188
Hpy166II	GTNNAC	1 cut(s)	191
Hpy188I	TCNGA	1 cut(s)	134
Hpy8I	GTNNAC	1 cut(s)	191
HpyAV	CCTTC	3 cut(s)	23, 52, 130
HpyCH4V	TGCA	2 cut(s)	90, 150
HpyF10VI	GCNNNNNNNGC	1 cut(s)	106
HpyF3I	CTNAG	1 cut(s)	200
Hsp92II	CATG	4 cut(s)	20, 73, 130, 166
HspAI	GCGC	2 cut(s)	20, 109
LmnI	GCTCC	1 cut(s)	66
LpnPI	CCDG	3 cut(s)	37, 76, 88
MbiI	CCGCTC	1 cut(s)	75
MboII	GAAGA	1 cut(s)	130
MhlI	GDGCHC	3 cut(s)	37, 84, 180
MlyI	GAGTC	1 cut(s)	144
MnlI	CCTC	3 cut(s)	152, 175, 209
MslI	CAYNNNNRTG	1 cut(s)	161
Mva1269I	GAATGC	1 cut(s)	150
MwoI	GCNNNNNNNGC	1 cut(s)	106
NlaIII	CATG	4 cut(s)	20, 73, 130, 166
NlaIV	GGNNCC	3 cut(s)	34, 35, 82
NmeAIII	GCCGAG	1 cut(s)	199
NsbI	TGCGCA	1 cut(s)	21
NspI	RCATGY	1 cut(s)	20
PaeI	GCATGC	1 cut(s)	20
PaeR7I	CTCGAG	1 cut(s)	179
PctI	GAATGC	1 cut(s)	150
PflMI	CCANNNNNTGG	1 cut(s)	102
PleI	GAGTC	1 cut(s)	143
PpsI	GAGTC	1 cut(s)	143
Psp124BI	GAGCTC	1 cut(s)	180
PspN4I	GGNNCC	3 cut(s)	34, 35, 82
PspOMI	GGGCCC	2 cut(s)	33, 80
PspPI	GGNCC	5 cut(s)	33, 34, 80, 81, 93
PspXI	VCTCGAGB	1 cut(s)	179
PstI	CTGCAG	1 cut(s)	92
RseI	CAYNNNNRTG	1 cut(s)	161
SacI	GAGCTC	1 cut(s)	180
Sau96I	GGNCC	5 cut(s)	33, 34, 80, 81, 93
SchI	GAGTC	1 cut(s)	144
SduI	GDGCHC	3 cut(s)	37, 84, 180
SetI	ASST	4 cut(s)	63, 180, 186, 201
SfcI	CTRYAG	1 cut(s)	88
Sfr274I	CTCGAG	1 cut(s)	179
SlaI	CTCGAG	1 cut(s)	179
SmiMI	CAYNNNNRTG	1 cut(s)	161
SmlI	CTYRAG	1 cut(s)	179
SmoI	CTYRAG	1 cut(s)	179
SphI	GCATGC	1 cut(s)	20
SsiI	CCGC	2 cut(s)	42, 75
SstI	GAGCTC	1 cut(s)	180
TaqI	TCGA	2 cut(s)	180, 228
TscAI	CASTG	1 cut(s)	107
TspDTI	ATGAA	2 cut(s)	179, 195
TspRI	CASTG	1 cut(s)	107
Van91I	CCANNNNNTGG	1 cut(s)	102
XagI	CCTNNNNNAGG	1 cut(s)	88
XceI	RCATGY	1 cut(s)	20
XhoI	CTCGAG	1 cut(s)	179

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.