RchiOBHm_Chr1g0353351

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0011874
Physical Location & Seq
Forward (+)
46597045 .. 46601437
4393 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57899

Sequence Viewer

Length: 210 bp
ATGGGAGGAGGCGAGCATGCGCACGGCGAAGGGGCCCACGGCGGAGACTTCAGGGCGAAGGTGTGGAGCATGAGCGGTGGGCCCTACTGCAGGCCCAAGCACTGGAAGCGCAACACGGCCTTCGCCATGTTCGGAGTCTTCCTCATCTGCATTCCCATCGCCATGAAATCTGCCGACCTCGAGAGGCTAAGCAAAGAAAATTGCTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

7.61

Weight (kDa)

8.96

Isoelectric Point (pI)

16.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 21
AccB7I CCANNNNNTGG 1 cut(s) 102
AccBSI CCGCTC 1 cut(s) 75
AciI CCGC 2 cut(s) 42, 75
AcuI CTGAAG 1 cut(s) 34
AfiI CCNNNNNNNGG 2 cut(s) 90, 102
Alw26I GTCTC 1 cut(s) 39
Ama87I CYCGRG 1 cut(s) 179
AoxI GGCC 4 cut(s) 33, 80, 92, 117
ApaI GGGCCC 2 cut(s) 37, 84
AspLEI GCGC 2 cut(s) 22, 111
AspS9I GGNCC 5 cut(s) 33, 34, 80, 81, 93
AvaI CYCGRG 1 cut(s) 179
BaeGI GKGCMC 2 cut(s) 37, 84
BanII GRGCYC 2 cut(s) 37, 84
BbsI GAAGAC 1 cut(s) 130
BccI CCATC 1 cut(s) 164
BceAI ACGGC 3 cut(s) 40, 55, 132
BcgI CGANNNNNNTGC 2 cut(s) 139, 173
BcoDI GTCTC 1 cut(s) 39
BfmI CTRYAG 1 cut(s) 88
BlpI GCTNAGC 1 cut(s) 188
BmeT110I CYCGRG 1 cut(s) 179
BmgT120I GGNCC 5 cut(s) 33, 34, 80, 81, 93
BmiI GGNNCC 3 cut(s) 34, 35, 82
BpiI GAAGAC 1 cut(s) 130
BplI GAGNNNNNCTC 2 cut(s) 126, 158
Bpu1102I GCTNAGC 1 cut(s) 188
BsaJI CCNNGG 1 cut(s) 37
Bsc4I CCNNNNNNNGG 2 cut(s) 90, 102
Bse1I ACTGG 1 cut(s) 107
BseDI CCNNGG 1 cut(s) 37
BseLI CCNNNNNNNGG 2 cut(s) 90, 102
BseNI ACTGG 1 cut(s) 107
BseRI GAGGAG 1 cut(s) 21
BseSI GKGCMC 2 cut(s) 37, 84
BshFI GGCC 4 cut(s) 35, 82, 94, 119
BsiHKCI CYCGRG 1 cut(s) 179
BslI CCNNNNNNNGG 2 cut(s) 90, 102
BsmAI GTCTC 1 cut(s) 39
BsmI GAATGC 1 cut(s) 150
BsnI GGCC 4 cut(s) 35, 82, 94, 119
BsoBI CYCGRG 1 cut(s) 179
Bsp120I GGGCCC 2 cut(s) 33, 80
Bsp1286I GDGCHC 2 cut(s) 37, 84
Bsp1720I GCTNAGC 1 cut(s) 188
BspACI CCGC 2 cut(s) 42, 75
BspANI GGCC 4 cut(s) 35, 82, 94, 119
BspLI GGNNCC 3 cut(s) 34, 35, 82
BspMAI CTGCAG 1 cut(s) 92
BsrBI CCGCTC 1 cut(s) 75
BsrI ACTGG 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 37
BstC8I GCNNGC 3 cut(s) 14, 18, 92
BstDEI CTNAG 1 cut(s) 188
BstDSI CCRYGG 1 cut(s) 37
BstENI CCTNNNNNAGG 1 cut(s) 88
BstHHI GCGC 2 cut(s) 22, 111
BstMAI GTCTC 1 cut(s) 39
BstMWI GCNNNNNNNGC 1 cut(s) 106
BstNSI RCATGY 1 cut(s) 20
BstSFI CTRYAG 1 cut(s) 88
BstSLI GKGCMC 2 cut(s) 37, 84
BstV2I GAAGAC 1 cut(s) 130
BsuRI GGCC 4 cut(s) 35, 82, 94, 119
BtgI CCRYGG 1 cut(s) 37
BtgZI GCGATG 1 cut(s) 142
BtsIMutI CAGTG 1 cut(s) 100
Cac8I GCNNGC 3 cut(s) 14, 18, 92
CfoI GCGC 2 cut(s) 22, 111
Cfr13I GGNCC 5 cut(s) 33, 34, 80, 81, 93
CviAII CATG 4 cut(s) 17, 70, 127, 163
CviJI RGCY 5 cut(s) 35, 82, 94, 119, 187
CviKI_1 RGCY 5 cut(s) 35, 82, 94, 119, 187
DdeI CTNAG 1 cut(s) 188
EciI GGCGGA 1 cut(s) 57
Eco24I GRGCYC 2 cut(s) 37, 84
Eco57I CTGAAG 1 cut(s) 34
Eco88I CYCGRG 1 cut(s) 179
EcoNI CCTNNNNNAGG 1 cut(s) 88
EcoO109I RGGNCCY 2 cut(s) 33, 81
EcoT38I GRGCYC 2 cut(s) 37, 84
FaeI CATG 4 cut(s) 20, 73, 130, 166
FaiI YATR 4 cut(s) 18, 71, 128, 164
FatI CATG 4 cut(s) 16, 69, 126, 162
FriOI GRGCYC 2 cut(s) 37, 84
FspAI RTGCGCAY 1 cut(s) 21
FspI TGCGCA 1 cut(s) 21
GlaI GCGC 2 cut(s) 21, 110
HaeIII GGCC 4 cut(s) 35, 82, 94, 119
HhaI GCGC 2 cut(s) 22, 111
Hin1II CATG 4 cut(s) 20, 73, 130, 166
Hin6I GCGC 2 cut(s) 20, 109
HinP1I GCGC 2 cut(s) 20, 109
HinfI GANTC 1 cut(s) 135
Hpy188I TCNGA 1 cut(s) 134
Hpy188III TCNNGA 1 cut(s) 181
HpyAV CCTTC 3 cut(s) 23, 52, 130
HpyCH4V TGCA 2 cut(s) 90, 150
HpyF10VI GCNNNNNNNGC 1 cut(s) 106
HpyF3I CTNAG 1 cut(s) 188
Hsp92II CATG 4 cut(s) 20, 73, 130, 166
HspAI GCGC 2 cut(s) 20, 109
LmnI GCTCC 1 cut(s) 66
LpnPI CCDG 3 cut(s) 37, 76, 88
MbiI CCGCTC 1 cut(s) 75
MboII GAAGA 1 cut(s) 130
MhlI GDGCHC 2 cut(s) 37, 84
MluCI AATT 1 cut(s) 199
MlyI GAGTC 1 cut(s) 144
MnlI CCTC 3 cut(s) 152, 177, 188
MslI CAYNNNNRTG 1 cut(s) 161
Mva1269I GAATGC 1 cut(s) 150
MwoI GCNNNNNNNGC 1 cut(s) 106
NlaIII CATG 4 cut(s) 20, 73, 130, 166
NlaIV GGNNCC 3 cut(s) 34, 35, 82
NsbI TGCGCA 1 cut(s) 21
NspI RCATGY 1 cut(s) 20
PaeI GCATGC 1 cut(s) 20
PaeR7I CTCGAG 1 cut(s) 179
PctI GAATGC 1 cut(s) 150
PflMI CCANNNNNTGG 1 cut(s) 102
PleI GAGTC 1 cut(s) 143
PpsI GAGTC 1 cut(s) 143
PspN4I GGNNCC 3 cut(s) 34, 35, 82
PspOMI GGGCCC 2 cut(s) 33, 80
PspPI GGNCC 5 cut(s) 33, 34, 80, 81, 93
PstI CTGCAG 1 cut(s) 92
RseI CAYNNNNRTG 1 cut(s) 161
Sau96I GGNCC 5 cut(s) 33, 34, 80, 81, 93
SchI GAGTC 1 cut(s) 144
SduI GDGCHC 2 cut(s) 37, 84
SetI ASST 2 cut(s) 63, 180
SfcI CTRYAG 1 cut(s) 88
Sfr274I CTCGAG 1 cut(s) 179
SlaI CTCGAG 1 cut(s) 179
SmiMI CAYNNNNRTG 1 cut(s) 161
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
SphI GCATGC 1 cut(s) 20
Sse9I AATT 1 cut(s) 199
SsiI CCGC 2 cut(s) 42, 75
TaqI TCGA 1 cut(s) 180
TasI AATT 1 cut(s) 199
TscAI CASTG 1 cut(s) 107
TspDTI ATGAA 1 cut(s) 179
TspRI CASTG 1 cut(s) 107
Van91I CCANNNNNTGG 1 cut(s) 102
XagI CCTNNNNNAGG 1 cut(s) 88
XceI RCATGY 1 cut(s) 20
XhoI CTCGAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.