AT4G21105

Cytochrome c oxidase subunit VII

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
11265479 .. 11267056
1578 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G21105.1

Sequence Viewer

Length: 207 bp
ATGTTGACTGAAACTCCATTTAGGCCACGAGAGAAGCTTCTGGAGAAACAGAGATTGTTCCAGAGCATCCAAAGGCACACTTACTTGAAAGGACCAATGGACAAGATCACTTCTGTTGCTATTCCTATTGCCTTGGCTGCAAGTTCTCTCTACATGATTGGAACAGGAATCTACAACATGTCGAATGGAATCGGCAAAAAGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.68

Weight (kDa)

9.9

Isoelectric Point (pI)

28.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
COX7a PF02238 11 - 63 1.9e-14 Cytochrome c oxidase subunit VII
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 177
AgsI TTSAA 1 cut(s) 88
AluBI AGCT 1 cut(s) 37
AluI AGCT 1 cut(s) 37
AoxI GGCC 1 cut(s) 23
ApeKI GCWGC 1 cut(s) 137
AspS9I GGNCC 1 cut(s) 92
AvaII GGWCC 1 cut(s) 92
BauI CACGAG 1 cut(s) 27
BbvI GCAGC 1 cut(s) 124
BisI GCNGC 1 cut(s) 138
BlsI GCNGC 1 cut(s) 139
Bme18I GGWCC 1 cut(s) 92
BmgT120I GGNCC 1 cut(s) 92
BmsI GCATC 1 cut(s) 75
BpmI CTGGAG 1 cut(s) 62
BsaJI CCNNGG 1 cut(s) 132
BsaXI ACNNNNNCTCC 1 cut(s) 28
BseDI CCNNGG 1 cut(s) 132
BseGI GGATG 1 cut(s) 66
BseXI GCAGC 1 cut(s) 124
BshFI GGCC 1 cut(s) 25
BsnI GGCC 1 cut(s) 25
Bsp143I GATC 1 cut(s) 105
BspANI GGCC 1 cut(s) 25
BssECI CCNNGG 1 cut(s) 132
BssMI GATC 1 cut(s) 105
BssSI CACGAG 1 cut(s) 27
BssT1I CCWWGG 1 cut(s) 132
Bst2BI CACGAG 1 cut(s) 27
BstF5I GGATG 1 cut(s) 66
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 181
BstV1I GCAGC 1 cut(s) 124
BsuRI GGCC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 66
Cfr13I GGNCC 1 cut(s) 92
CviAII CATG 2 cut(s) 154, 178
CviJI RGCY 3 cut(s) 25, 37, 137
CviKI_1 RGCY 3 cut(s) 25, 37, 137
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
Eco130I CCWWGG 1 cut(s) 132
Eco47I GGWCC 1 cut(s) 92
EcoT14I CCWWGG 1 cut(s) 132
ErhI CCWWGG 1 cut(s) 132
FaeI CATG 2 cut(s) 157, 181
FaiI YATR 2 cut(s) 155, 179
FalI AAGNNNNNCTT 2 cut(s) 64, 96
FatI CATG 2 cut(s) 153, 177
Fnu4HI GCNGC 1 cut(s) 138
FokI GGATG 1 cut(s) 53
Fsp4HI GCNGC 1 cut(s) 138
GluI GCNGC 1 cut(s) 138
GsuI CTGGAG 1 cut(s) 62
HaeIII GGCC 1 cut(s) 25
Hin1II CATG 2 cut(s) 157, 181
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 35
HinfI GANTC 2 cut(s) 168, 189
Hpy166II GTNNAC 1 cut(s) 6
Hpy188III TCNNGA 2 cut(s) 41, 61
Hpy8I GTNNAC 1 cut(s) 6
HpyCH4V TGCA 1 cut(s) 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
Hsp92II CATG 2 cut(s) 157, 181
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 3 cut(s) 26, 74, 150
Lsp1109I GCAGC 1 cut(s) 124
LweI GCATC 1 cut(s) 75
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 137
NdeII GATC 1 cut(s) 105
NlaIII CATG 2 cut(s) 157, 181
NspI RCATGY 1 cut(s) 181
PciI ACATGT 1 cut(s) 177
PfeI GAWTC 2 cut(s) 168, 189
PkrI GCNGC 1 cut(s) 139
PscI ACATGT 1 cut(s) 177
PspPI GGNCC 1 cut(s) 92
SatI GCNGC 1 cut(s) 138
Sau3AI GATC 1 cut(s) 105
Sau96I GGNCC 1 cut(s) 92
SetI ASST 1 cut(s) 39
SfaNI GCATC 1 cut(s) 75
SinI GGWCC 1 cut(s) 92
StyI CCWWGG 1 cut(s) 132
TaqI TCGA 1 cut(s) 182
TfiI GAWTC 2 cut(s) 168, 189
TseI GCWGC 1 cut(s) 137
VpaK11BI GGWCC 1 cut(s) 92
XceI RCATGY 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.