AT4G30740

QWRF motif-containing protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Reverse (-)
14979246 .. 14979864
619 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G30740.1

Sequence Viewer

Length: 276 bp
ATGAGAATCCTCAGTGTTTCGTTTCAGTCTGATTCAGTCTCAGTCCCTGTTAGTAAGAAGGAGAGACTGGTTAGTAGTTCTTCTGGTGATCGAACATTGAGACCTTCTTCGAATATAGCTCAAAAGCATAAGGCTGAAACGACCTCTGTATCAAGGAAACCTACGCCAGAGAGGAAAAGAAGTCCATTGAAAGGGAAGAATAATGTGTCTGATCTTTCAGAGAATTCGAAACCTGTAGATGGTCCTCATAGTCGGTTAATAGAACAGCATCGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.08

Weight (kDa)

10.72

Isoelectric Point (pI)

68.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 223
AfiI CCNNNNNNNGG 2 cut(s) 191, 239
AgsI TTSAA 1 cut(s) 190
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
Alw26I GTCTC 3 cut(s) 43, 58, 94
AlwNI CAGNNNCTG 1 cut(s) 47
ApoI RAATTY 1 cut(s) 223
AspS9I GGNCC 1 cut(s) 242
AsuHPI GGTGA 1 cut(s) 98
AsuII TTCGAA 2 cut(s) 110, 227
AvaII GGWCC 1 cut(s) 242
BaeI ACNNNNGTAYC 2 cut(s) 132, 165
BccI CCATC 1 cut(s) 233
BcoDI GTCTC 3 cut(s) 43, 58, 94
BfmI CTRYAG 1 cut(s) 234
Bme18I GGWCC 1 cut(s) 242
BmgT120I GGNCC 1 cut(s) 242
Bpu14I TTCGAA 2 cut(s) 110, 227
BsaI GGTCTC 1 cut(s) 94
Bsc4I CCNNNNNNNGG 2 cut(s) 191, 239
Bse1I ACTGG 1 cut(s) 72
BseLI CCNNNNNNNGG 2 cut(s) 191, 239
BseMII CTCAG 2 cut(s) 25, 54
BseNI ACTGG 1 cut(s) 72
BslFI GGGAC 1 cut(s) 29
BslI CCNNNNNNNGG 2 cut(s) 191, 239
BsmAI GTCTC 3 cut(s) 43, 58, 94
BsmFI GGGAC 1 cut(s) 29
Bso31I GGTCTC 1 cut(s) 94
Bsp119I TTCGAA 2 cut(s) 110, 227
Bsp143I GATC 2 cut(s) 88, 211
BspCNI CTCAG 2 cut(s) 24, 53
BspT104I TTCGAA 2 cut(s) 110, 227
BspTNI GGTCTC 1 cut(s) 94
BsrI ACTGG 1 cut(s) 72
BssMI GATC 2 cut(s) 88, 211
BstBI TTCGAA 2 cut(s) 110, 227
BstDEI CTNAG 2 cut(s) 11, 40
BstKTI GATC 2 cut(s) 91, 214
BstMAI GTCTC 3 cut(s) 43, 58, 94
BstMBI GATC 2 cut(s) 88, 211
BstSFI CTRYAG 1 cut(s) 234
BtsIMutI CAGTG 1 cut(s) 19
CaiI CAGNNNCTG 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 242
CviJI RGCY 2 cut(s) 119, 134
CviKI_1 RGCY 2 cut(s) 119, 134
DdeI CTNAG 2 cut(s) 11, 40
DpnI GATC 2 cut(s) 90, 213
DpnII GATC 2 cut(s) 88, 211
Eco31I GGTCTC 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 242
EcoRI GAATTC 1 cut(s) 223
FaiI YATR 3 cut(s) 116, 129, 249
FaqI GGGAC 1 cut(s) 29
HinfI GANTC 2 cut(s) 6, 32
HphI GGTGA 1 cut(s) 98
Hpy188I TCNGA 3 cut(s) 31, 211, 220
HpyAV CCTTC 2 cut(s) 52, 114
HpyF3I CTNAG 2 cut(s) 11, 40
Kzo9I GATC 2 cut(s) 88, 211
LpnPI CCDG 5 cut(s) 53, 60, 69, 180, 246
MalI GATC 2 cut(s) 90, 213
MboI GATC 2 cut(s) 88, 211
MboII GAAGA 3 cut(s) 72, 99, 208
MluCI AATT 1 cut(s) 223
MnlI CCTC 4 cut(s) 20, 154, 165, 255
MseI TTAA 1 cut(s) 257
NdeII GATC 2 cut(s) 88, 211
NspV TTCGAA 2 cut(s) 110, 227
PfeI GAWTC 2 cut(s) 6, 32
PspPI GGNCC 1 cut(s) 242
PstNI CAGNNNCTG 1 cut(s) 47
SaqAI TTAA 1 cut(s) 257
Sau3AI GATC 2 cut(s) 88, 211
Sau96I GGNCC 1 cut(s) 242
SetI ASST 5 cut(s) 106, 121, 146, 163, 235
SfcI CTRYAG 1 cut(s) 234
SfuI TTCGAA 2 cut(s) 110, 227
SgeI CNNG 6 cut(s) 59, 80, 96, 165, 179, 245
SinI GGWCC 1 cut(s) 242
Sse9I AATT 1 cut(s) 223
TaqI TCGA 3 cut(s) 91, 110, 227
TasI AATT 1 cut(s) 223
TfiI GAWTC 2 cut(s) 6, 32
Tru1I TTAA 1 cut(s) 257
Tru9I TTAA 1 cut(s) 257
TscAI CASTG 1 cut(s) 19
TspRI CASTG 1 cut(s) 19
VpaK11BI GGWCC 1 cut(s) 242
XapI RAATTY 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.