Rmu_co8388711.1_g000001

QWRF motif-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8388711.1
Physical Location & Seq
Reverse (-)
16 .. 919
904 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8388711.1_g000001.1.cds

Sequence Viewer

Length: 420 bp
atggactaccttgacgactgggctttacttgaaagagatcatattgctgctttctccggggctatggaagatttggaggcaagcactctccgtcttccagtaactggaggggcaaggacggatattgactctttgaaggtagctatctgctcagctgttgatgtgatgcaggcaatgggatcctccatatgctctttgctctcaagggtggagggggtgaatggtttggtttcagaacttgctgttgtagcagcgcaagagaaagccatgcttgacgaatgtgaagcattgctggcttcagcagcagttatgcaggtagaggaatacagccttaagacgcaactcatacaaatgaaacaagatttgggaactgtcagcagccaattttggcaaccaagacagcttcttgaacctgactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.07

Weight (kDa)

4.22

Isoelectric Point (pI)

30.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 304
AccB7I CCANNNNNTGG 1 cut(s) 104
AclWI GGATC 2 cut(s) 174, 187
AcuI CTGAAG 1 cut(s) 282
AfiI CCNNNNNNNGG 1 cut(s) 104
AflII CTTAAG 1 cut(s) 332
AgsI TTSAA 3 cut(s) 32, 136, 410
AjuI GAANNNNNNNTTGG 2 cut(s) 347, 379
AluBI AGCT 3 cut(s) 143, 155, 403
AluI AGCT 3 cut(s) 143, 155, 403
AlwI GGATC 2 cut(s) 174, 187
AlwNI CAGNNNCTG 1 cut(s) 104
ApeKI GCWGC 4 cut(s) 47, 251, 302, 378
AspLEI GCGC 1 cut(s) 256
AsuC2I CCSGG 1 cut(s) 58
AsuHPI GGTGA 1 cut(s) 229
BamHI GGATCC 1 cut(s) 179
BbsI GAAGAC 1 cut(s) 86
BbvI GCAGC 4 cut(s) 34, 263, 314, 390
BcnI CCSGG 1 cut(s) 58
BfaI CTAG 1 cut(s) 418
BfrI CTTAAG 1 cut(s) 332
BfuAI ACCTGC 1 cut(s) 304
BisI GCNGC 4 cut(s) 48, 252, 303, 379
BlpI GCTNAGC 1 cut(s) 151
BlsI GCNGC 4 cut(s) 49, 253, 304, 380
Bme1390I CCNGG 1 cut(s) 58
BmiI GGNNCC 1 cut(s) 181
BmrFI CCNGG 1 cut(s) 58
BmrI ACTGGG 1 cut(s) 28
BmsI GCATC 1 cut(s) 156
BmuI ACTGGG 1 cut(s) 28
BpiI GAAGAC 1 cut(s) 86
BpmI CTGGAG 1 cut(s) 126
Bpu1102I GCTNAGC 1 cut(s) 151
BpuEI CTTGAG 1 cut(s) 187
BpuMI CCSGG 1 cut(s) 58
BsaJI CCNNGG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse1I ACTGG 3 cut(s) 23, 98, 109
Bse3DI GCAATG 2 cut(s) 180, 287
BseDI CCNNGG 1 cut(s) 57
BseLI CCNNNNNNNGG 1 cut(s) 104
BseMI GCAATG 2 cut(s) 180, 287
BseMII CTCAG 1 cut(s) 165
BseNI ACTGG 3 cut(s) 23, 98, 109
BseXI GCAGC 4 cut(s) 34, 263, 314, 390
BsiSI CCGG 1 cut(s) 57
BslI CCNNNNNNNGG 1 cut(s) 104
Bsp143I GATC 2 cut(s) 37, 179
Bsp1720I GCTNAGC 1 cut(s) 151
BspCNI CTCAG 1 cut(s) 164
BspLI GGNNCC 1 cut(s) 181
BspMI ACCTGC 1 cut(s) 304
BspPI GGATC 2 cut(s) 174, 187
BspTI CTTAAG 1 cut(s) 332
BsrDI GCAATG 2 cut(s) 180, 287
BsrI ACTGG 3 cut(s) 23, 98, 109
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 2 cut(s) 37, 179
Bst4CI ACNGT 1 cut(s) 373
BstAFI CTTAAG 1 cut(s) 332
BstC8I GCNNGC 3 cut(s) 82, 171, 294
BstDEI CTNAG 1 cut(s) 151
BstHHI GCGC 1 cut(s) 256
BstKTI GATC 2 cut(s) 40, 182
BstMBI GATC 2 cut(s) 37, 179
BstMWI GCNNNNNNNGC 3 cut(s) 248, 293, 302
BstSCI CCNGG 1 cut(s) 56
BstV1I GCAGC 4 cut(s) 34, 263, 314, 390
BstV2I GAAGAC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 179
BstYI RGATCY 1 cut(s) 179
BveI ACCTGC 1 cut(s) 304
Cac8I GCNNGC 3 cut(s) 82, 171, 294
CaiI CAGNNNCTG 1 cut(s) 104
CfoI GCGC 1 cut(s) 256
CseI GACGC 1 cut(s) 346
CviAII CATG 1 cut(s) 268
CviJI RGCY 9 cut(s) 23, 62, 143, 155, 266, 296, 330, 381, 403
CviKI_1 RGCY 9 cut(s) 23, 62, 143, 155, 266, 296, 330, 381, 403
DdeI CTNAG 1 cut(s) 151
DpnI GATC 2 cut(s) 39, 181
DpnII GATC 2 cut(s) 37, 179
Eco57I CTGAAG 1 cut(s) 282
FaeI CATG 1 cut(s) 271
FaiI YATR 7 cut(s) 42, 65, 188, 190, 269, 311, 347
FalI AAGNNNNNCTT 2 cut(s) 255, 287
FatI CATG 1 cut(s) 267
FauNDI CATATG 1 cut(s) 188
Fnu4HI GCNGC 4 cut(s) 48, 252, 303, 379
Fsp4HI GCNGC 4 cut(s) 48, 252, 303, 379
FspBI CTAG 1 cut(s) 418
GlaI GCGC 1 cut(s) 255
GluI GCNGC 4 cut(s) 48, 252, 303, 379
GsuI CTGGAG 1 cut(s) 126
HapII CCGG 1 cut(s) 57
HgaI GACGC 1 cut(s) 346
HhaI GCGC 1 cut(s) 256
Hin1II CATG 1 cut(s) 271
Hin6I GCGC 1 cut(s) 254
HinP1I GCGC 1 cut(s) 254
HinfI GANTC 1 cut(s) 128
HpaII CCGG 1 cut(s) 57
HphI GGTGA 1 cut(s) 229
Hpy188I TCNGA 1 cut(s) 235
Hpy188III TCNNGA 1 cut(s) 407
HpyAV CCTTC 1 cut(s) 130
HpyCH4III ACNGT 1 cut(s) 373
HpyCH4V TGCA 2 cut(s) 169, 313
HpyF10VI GCNNNNNNNGC 3 cut(s) 248, 293, 302
HpyF3I CTNAG 1 cut(s) 151
Hsp92II CATG 1 cut(s) 271
HspAI GCGC 1 cut(s) 254
Kzo9I GATC 2 cut(s) 37, 179
LpnPI CCDG 7 cut(s) 4, 70, 90, 111, 155, 278, 299
Lsp1109I GCAGC 4 cut(s) 34, 263, 314, 390
LweI GCATC 1 cut(s) 156
MaeI CTAG 1 cut(s) 418
MaeIII GTNAC 1 cut(s) 100
MalI GATC 2 cut(s) 39, 181
MboI GATC 2 cut(s) 37, 179
MboII GAAGA 2 cut(s) 80, 86
MflI RGATCY 1 cut(s) 179
MluCI AATT 1 cut(s) 383
MlyI GAGTC 1 cut(s) 122
MnlI CCTC 5 cut(s) 70, 101, 193, 205, 313
MseI TTAA 1 cut(s) 333
MslI CAYNNNNRTG 1 cut(s) 350
MspA1I CMGCKG 1 cut(s) 155
MspCI CTTAAG 1 cut(s) 332
MspI CCGG 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 58
MwoI GCNNNNNNNGC 3 cut(s) 248, 293, 302
NciI CCSGG 1 cut(s) 58
NdeI CATATG 1 cut(s) 188
NdeII GATC 2 cut(s) 37, 179
NlaIII CATG 1 cut(s) 271
NlaIV GGNNCC 1 cut(s) 181
PflMI CCANNNNNTGG 1 cut(s) 104
PkrI GCNGC 4 cut(s) 49, 253, 304, 380
PleI GAGTC 1 cut(s) 122
PpsI GAGTC 1 cut(s) 122
PspN4I GGNNCC 1 cut(s) 181
PstNI CAGNNNCTG 1 cut(s) 104
PsuI RGATCY 1 cut(s) 179
PvuII CAGCTG 1 cut(s) 155
RseI CAYNNNNRTG 1 cut(s) 350
SaqAI TTAA 1 cut(s) 333
SatI GCNGC 4 cut(s) 48, 252, 303, 379
Sau3AI GATC 2 cut(s) 37, 179
SchI GAGTC 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 58
SetI ASST 7 cut(s) 12, 141, 145, 157, 318, 405, 415
SfaNI GCATC 1 cut(s) 156
SmiMI CAYNNNNRTG 1 cut(s) 350
SmlI CTYRAG 2 cut(s) 202, 332
SmoI CTYRAG 2 cut(s) 202, 332
Sse9I AATT 1 cut(s) 383
SspMI CTAG 1 cut(s) 418
StyD4I CCNGG 1 cut(s) 56
TaaI ACNGT 1 cut(s) 373
TasI AATT 1 cut(s) 383
Tru1I TTAA 1 cut(s) 333
Tru9I TTAA 1 cut(s) 333
TseI GCWGC 4 cut(s) 47, 251, 302, 378
TspDTI ATGAA 1 cut(s) 368
TspGWI ACGGA 2 cut(s) 80, 134
Van91I CCANNNNNTGG 1 cut(s) 104
Vha464I CTTAAG 1 cut(s) 332
XspI CTAG 1 cut(s) 418
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.