AT4G37010

EF-hand domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0013400
Physical Location & Seq
Forward (+)
17444129 .. 17445615
1487 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G37010.2

Sequence Viewer

Length: 504 bp
ATGTCGGAAGCAGCACAGCTCAGAAGAGGTCTAAAGCCTAAAGGGAAGACTTATGGGTTGACCAATCAGAAGAGACGAGAGATCAGAGAGATCTTTGATCTTTTCGACATAGACGGTTCAGGTAGCATCGATGCTAGCGAGCTCAACGTTGCTATGAGGTCTCTTGGATTTGAGATGAATAATCAGCAAATAAACGAATTGATGGCAGAAGTAGATAAAAACCAAAGTGGAGCCATAGATTTCGACGAATTTGTGCATATGATGACAACCAAATTCGGAGAACGAGACTCCATAGACGAATTGTCTAAGGCGTTTAAGATCATTGACCACGACAATAATGGGAAGATTTCACCTCGTGATATAAAGATGATTGCTAAAGAATTGGGAGAAAATTTCACAGATAATGATATAGAAGAAATGATCGAAGAAGCAGACCGTGACAAAGATGGAGAAGTTAACTTGGAGGAGTTCATGAAGATGATGAAGAGAACCTCTTACGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
EF-hand_1 EF-hand_5 EF-hand_6

Protein Analysis

167

Amino Acids

19.16

Weight (kDa)

4.69

Isoelectric Point (pI)

40.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AIF-1 PF21008 29 - 95 1e-05 Allograft inflammatory factor 1
EF-hand_7 PF13499 30 - 93 2.5e-16 EF-hand domain pair
EF-hand_1 PF00036 31 - 59 1.5e-07 EF hand domain
EF-hand_6 PF13405 31 - 60 7.8e-08 EF-hand domain
EF-hand_8 PF13833 44 - 93 3.8e-09 EF-hand domain pair
EF-hand_1 PF00036 68 - 94 9.1e-08 EF hand domain
EF-hand_7 PF13499 104 - 166 2.7e-16 EF-hand domain pair
EF-hand_8 PF13833 120 - 167 1.2e-08 EF-hand domain pair
EF-hand_1 PF00036 140 - 167 4e-08 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013400)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G50360 AT4G37010 AT4G37010
fragaria_vesca FvH4_1g15980
malus_domestica MD02G1171500.v1.1 MD15G1283300.v1.1
prunus_persica Prupe.7G133900_v2.0.a1 Prupe.7G133900_v2.0.a1
pyrus_communis pycom02g13820 pycom15g24650
rosa_chinensis RchiOBHm_Chr2g0105581
rosa_laevigata RLG00000017438
rosa_rugosa Rorug02G0128400
rosa_samantha Rh2AG180000 Rh2BG189100 Rh2CG184300 Rh2DG185800
rosa_wichuraiana Rw2G014080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 147
AcsI RAATTY 3 cut(s) 248, 272, 391
AdeI CACNNNGTG 1 cut(s) 356
AhdI GACNNNNNGTC 1 cut(s) 301
AluBI AGCT 2 cut(s) 19, 142
AluI AGCT 2 cut(s) 19, 142
Alw21I GWGCWC 1 cut(s) 144
Alw26I GTCTC 3 cut(s) 67, 165, 279
ApeKI GCWGC 1 cut(s) 11
ApoI RAATTY 3 cut(s) 248, 272, 391
AsuHPI GGTGA 1 cut(s) 342
AsuNHI GCTAGC 1 cut(s) 134
BanII GRGCYC 1 cut(s) 144
BauI CACGAG 1 cut(s) 354
BbsI GAAGAC 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 144
BbvI GCAGC 1 cut(s) 23
BccI CCATC 2 cut(s) 196, 440
BcoDI GTCTC 3 cut(s) 67, 165, 279
BfaI CTAG 1 cut(s) 135
BglII AGATCT 1 cut(s) 90
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
BmeRI GACNNNNNGTC 1 cut(s) 301
BmiI GGNNCC 1 cut(s) 232
BmsI GCATC 2 cut(s) 121, 135
BmtI GCTAGC 1 cut(s) 138
BpiI GAAGAC 1 cut(s) 53
Bsa29I ATCGAT 1 cut(s) 129
BsaI GGTCTC 1 cut(s) 165
BseCI ATCGAT 1 cut(s) 129
BseMII CTCAG 1 cut(s) 34
BseRI GAGGAG 1 cut(s) 479
BseXI GCAGC 1 cut(s) 23
BshVI ATCGAT 1 cut(s) 129
BsiHKAI GWGCWC 1 cut(s) 144
BsmAI GTCTC 3 cut(s) 67, 165, 279
BsmBI CGTCTC 1 cut(s) 67
Bso31I GGTCTC 1 cut(s) 165
Bsp1286I GDGCHC 1 cut(s) 144
Bsp143I GATC 5 cut(s) 81, 90, 97, 318, 420
BspCNI CTCAG 1 cut(s) 33
BspDI ATCGAT 1 cut(s) 129
BspHI TCATGA 1 cut(s) 471
BspLI GGNNCC 1 cut(s) 232
BspOI GCTAGC 1 cut(s) 138
BspTNI GGTCTC 1 cut(s) 165
BssMI GATC 5 cut(s) 81, 90, 97, 318, 420
BssSI CACGAG 1 cut(s) 354
Bst2BI CACGAG 1 cut(s) 354
Bst4CI ACNGT 2 cut(s) 116, 437
Bst6I CTCTTC 3 cut(s) 19, 65, 479
BstC8I GCNNGC 2 cut(s) 136, 140
BstDEI CTNAG 2 cut(s) 20, 306
BstKTI GATC 5 cut(s) 84, 93, 100, 321, 423
BstMAI GTCTC 3 cut(s) 67, 165, 279
BstMBI GATC 5 cut(s) 81, 90, 97, 318, 420
BstV1I GCAGC 1 cut(s) 23
BstV2I GAAGAC 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 90
BstYI RGATCY 1 cut(s) 90
Bsu15I ATCGAT 1 cut(s) 129
BsuTUI ATCGAT 1 cut(s) 129
Cac8I GCNNGC 2 cut(s) 136, 140
CciI TCATGA 1 cut(s) 471
ClaI ATCGAT 1 cut(s) 129
CviAII CATG 1 cut(s) 472
CviJI RGCY 5 cut(s) 19, 37, 142, 233, 501
CviKI_1 RGCY 5 cut(s) 19, 37, 142, 233, 501
DdeI CTNAG 2 cut(s) 20, 306
DpnI GATC 5 cut(s) 83, 92, 99, 320, 422
DpnII GATC 5 cut(s) 81, 90, 97, 318, 420
DraIII CACNNNGTG 1 cut(s) 356
DriI GACNNNNNGTC 1 cut(s) 301
Eam1104I CTCTTC 3 cut(s) 19, 65, 479
Eam1105I GACNNNNNGTC 1 cut(s) 301
EarI CTCTTC 3 cut(s) 19, 65, 479
Ecl136II GAGCTC 1 cut(s) 142
Eco24I GRGCYC 1 cut(s) 144
Eco31I GGTCTC 1 cut(s) 165
Eco53kI GAGCTC 1 cut(s) 142
EcoICRI GAGCTC 1 cut(s) 142
EcoT38I GRGCYC 1 cut(s) 144
Esp3I CGTCTC 1 cut(s) 67
FaeI CATG 1 cut(s) 475
FatI CATG 1 cut(s) 471
FauNDI CATATG 1 cut(s) 258
Fnu4HI GCNGC 1 cut(s) 12
FriOI GRGCYC 1 cut(s) 144
Fsp4HI GCNGC 1 cut(s) 12
FspBI CTAG 1 cut(s) 135
GluI GCNGC 1 cut(s) 12
Hin1II CATG 1 cut(s) 475
HincII GTYRAC 2 cut(s) 60, 457
HindII GTYRAC 2 cut(s) 60, 457
HinfI GANTC 1 cut(s) 287
HpaI GTTAAC 1 cut(s) 457
HphI GGTGA 1 cut(s) 342
Hpy166II GTNNAC 2 cut(s) 60, 457
Hpy188I TCNGA 5 cut(s) 7, 23, 69, 86, 278
Hpy188III TCNNGA 2 cut(s) 356, 472
Hpy8I GTNNAC 2 cut(s) 60, 457
Hpy99I CGWCG 1 cut(s) 248
HpyCH4III ACNGT 2 cut(s) 116, 437
HpyCH4IV ACGT 1 cut(s) 147
HpyCH4V TGCA 1 cut(s) 256
HpyF3I CTNAG 2 cut(s) 20, 306
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 1 cut(s) 475
KspAI GTTAAC 1 cut(s) 457
Kzo9I GATC 5 cut(s) 81, 90, 97, 318, 420
LmnI GCTCC 1 cut(s) 230
LpnPI CCDG 1 cut(s) 105
Lsp1109I GCAGC 1 cut(s) 23
LweI GCATC 2 cut(s) 121, 135
MaeI CTAG 1 cut(s) 135
MaeII ACGT 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 437
MalI GATC 5 cut(s) 83, 92, 99, 320, 422
MboI GATC 5 cut(s) 81, 90, 97, 318, 420
MboII GAAGA 8 cut(s) 36, 58, 82, 355, 425, 437, 487, 496
MflI RGATCY 1 cut(s) 90
MhlI GDGCHC 1 cut(s) 144
MluCI AATT 6 cut(s) 197, 248, 272, 299, 380, 391
MlyI GAGTC 1 cut(s) 281
MnlI CCTC 5 cut(s) 20, 150, 363, 457, 502
MseI TTAA 2 cut(s) 315, 456
MslI CAYNNNNRTG 1 cut(s) 476
NdeI CATATG 1 cut(s) 258
NdeII GATC 5 cut(s) 81, 90, 97, 318, 420
NheI GCTAGC 1 cut(s) 134
NlaIII CATG 1 cut(s) 475
NlaIV GGNNCC 1 cut(s) 232
NmuCI GTSAC 1 cut(s) 437
PagI TCATGA 1 cut(s) 471
PcsI WCGNNNNNNNCGW 1 cut(s) 135
PkrI GCNGC 1 cut(s) 13
PleI GAGTC 1 cut(s) 281
PpsI GAGTC 1 cut(s) 281
Psp124BI GAGCTC 1 cut(s) 144
Psp1406I AACGTT 1 cut(s) 147
PspN4I GGNNCC 1 cut(s) 232
PsuI RGATCY 1 cut(s) 90
RseI CAYNNNNRTG 1 cut(s) 476
SacI GAGCTC 1 cut(s) 144
SaqAI TTAA 2 cut(s) 315, 456
SatI GCNGC 1 cut(s) 12
Sau3AI GATC 5 cut(s) 81, 90, 97, 318, 420
SchI GAGTC 1 cut(s) 281
SduI GDGCHC 1 cut(s) 144
SetI ASST 8 cut(s) 21, 31, 124, 144, 150, 161, 355, 494
SfaNI GCATC 2 cut(s) 121, 135
SmiMI CAYNNNNRTG 1 cut(s) 476
Sse9I AATT 6 cut(s) 197, 248, 272, 299, 380, 391
SspMI CTAG 1 cut(s) 135
SstI GAGCTC 1 cut(s) 144
TaaI ACNGT 2 cut(s) 116, 437
TaiI ACGT 1 cut(s) 150
TaqI TCGA 4 cut(s) 105, 129, 243, 423
TasI AATT 6 cut(s) 197, 248, 272, 299, 380, 391
Tru1I TTAA 2 cut(s) 315, 456
Tru9I TTAA 2 cut(s) 315, 456
TseFI GTSAC 1 cut(s) 437
TseI GCWGC 1 cut(s) 11
Tsp45I GTSAC 1 cut(s) 437
TspDTI ATGAA 4 cut(s) 191, 460, 488, 497
XapI RAATTY 3 cut(s) 248, 272, 391
XcmI CCANNNNNNNNNTGG 1 cut(s) 335
XspI CTAG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.