AT5G12140

Cysteine proteinase inhibitor

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
3922591 .. 3924058
1468 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G12140.1

Sequence Viewer

Length: 306 bp
ATGGCGGATCAACAAGCAGGAACAATCGTCGGAGGAGTTCGCGATATTGATGCAAATGCTAATGATCTTCAAGTCGAGAGTCTCGCTCGTTTCGCTGTCGATGAGCATAACAAGAACGAGAACTTGACTCTGGAGTACAAGAGGCTCCTTGGTGCGAAAACACAGGTTGTGGCAGGAACAATGCACCATCTAACTGTGGAGGTGGCTGATGGTGAGACCAATAAGGTCTATGAGGCCAAGGTTTTGGAGAAAGCTTGGGAGAATCTCAAGCAGTTGGAGAGTTTCAACCACCTTCACGATGTTTAA

Protein Analysis

101

Amino Acids

11.26

Weight (kDa)

5.07

Isoelectric Point (pI)

22.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cystatin PF00031 11 - 94 1.1e-14 Cystatin domain
SQAPI PF16845 19 - 97 2.2e-22 Aspartic acid proteinase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 42
AciI CCGC 1 cut(s) 5
AclWI GGATC 1 cut(s) 15
AfaI GTAC 1 cut(s) 137
AgsI TTSAA 2 cut(s) 71, 286
AluBI AGCT 1 cut(s) 254
AluI AGCT 1 cut(s) 254
Alw26I GTCTC 2 cut(s) 86, 209
AlwI GGATC 1 cut(s) 15
AoxI GGCC 1 cut(s) 234
AsuHPI GGTGA 1 cut(s) 224
BccI CCATC 2 cut(s) 195, 203
BcgI CGANNNNNNTGC 2 cut(s) 32, 66
BcoDI GTCTC 2 cut(s) 86, 209
BmiI GGNNCC 1 cut(s) 146
BmsI GCATC 1 cut(s) 40
BplI GAGNNNNNCTC 2 cut(s) 70, 102
BpmI CTGGAG 1 cut(s) 152
BpuEI CTTGAG 1 cut(s) 251
BsaI GGTCTC 1 cut(s) 209
BsaJI CCNNGG 2 cut(s) 148, 237
BseDI CCNNGG 2 cut(s) 148, 237
BseRI GAGGAG 1 cut(s) 48
Bsh1236I CGCG 1 cut(s) 42
BshFI GGCC 1 cut(s) 236
BsmAI GTCTC 2 cut(s) 86, 209
BsnI GGCC 1 cut(s) 236
Bso31I GGTCTC 1 cut(s) 209
Bsp143I GATC 2 cut(s) 7, 64
Bsp68I TCGCGA 1 cut(s) 42
BspACI CCGC 1 cut(s) 5
BspANI GGCC 1 cut(s) 236
BspFNI CGCG 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 146
BspPI GGATC 1 cut(s) 15
BspTNI GGTCTC 1 cut(s) 209
BssECI CCNNGG 2 cut(s) 148, 237
BssMI GATC 2 cut(s) 7, 64
BssT1I CCWWGG 2 cut(s) 148, 237
Bst4CI ACNGT 1 cut(s) 196
BstFNI CGCG 1 cut(s) 42
BstKTI GATC 2 cut(s) 10, 67
BstMAI GTCTC 2 cut(s) 86, 209
BstMBI GATC 2 cut(s) 7, 64
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstUI CGCG 1 cut(s) 42
BstXI CCANNNNNNTGG 1 cut(s) 244
BsuRI GGCC 1 cut(s) 236
BtuMI TCGCGA 1 cut(s) 42
Csp6I GTAC 1 cut(s) 136
CviJI RGCY 4 cut(s) 145, 206, 236, 254
CviKI_1 RGCY 4 cut(s) 145, 206, 236, 254
CviQI GTAC 1 cut(s) 136
DpnI GATC 2 cut(s) 9, 66
DpnII GATC 2 cut(s) 7, 64
EciI GGCGGA 1 cut(s) 20
Eco130I CCWWGG 2 cut(s) 148, 237
Eco31I GGTCTC 1 cut(s) 209
EcoT14I CCWWGG 2 cut(s) 148, 237
ErhI CCWWGG 2 cut(s) 148, 237
FaiI YATR 2 cut(s) 108, 231
GsuI CTGGAG 1 cut(s) 152
HaeIII GGCC 1 cut(s) 236
HindIII AAGCTT 1 cut(s) 252
HinfI GANTC 3 cut(s) 79, 127, 262
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 1 cut(s) 32
Hpy188III TCNNGA 4 cut(s) 41, 76, 131, 296
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 1 cut(s) 302
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4V TGCA 2 cut(s) 53, 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
Kzo9I GATC 2 cut(s) 7, 64
LmnI GCTCC 1 cut(s) 150
LpnPI CCDG 4 cut(s) 3, 116, 149, 159
LweI GCATC 1 cut(s) 40
MalI GATC 2 cut(s) 9, 66
MboI GATC 2 cut(s) 7, 64
MboII GAAGA 1 cut(s) 59
MlyI GAGTC 2 cut(s) 88, 121
MmeI TCCRAC 2 cut(s) 10, 255
MnlI CCTC 4 cut(s) 26, 135, 193, 226
MseI TTAA 1 cut(s) 304
MvnI CGCG 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 2 cut(s) 7, 64
NlaIV GGNNCC 1 cut(s) 146
NruI TCGCGA 1 cut(s) 42
PfeI GAWTC 1 cut(s) 262
PleI GAGTC 2 cut(s) 87, 121
PpsI GAGTC 2 cut(s) 87, 121
PspN4I GGNNCC 1 cut(s) 146
RruI TCGCGA 1 cut(s) 42
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
SaqAI TTAA 1 cut(s) 304
Sau3AI GATC 2 cut(s) 7, 64
SchI GAGTC 2 cut(s) 88, 121
SetI ASST 6 cut(s) 168, 204, 228, 243, 256, 294
SfaNI GCATC 1 cut(s) 40
SmlI CTYRAG 1 cut(s) 266
SmoI CTYRAG 1 cut(s) 266
SsiI CCGC 1 cut(s) 5
StyI CCWWGG 2 cut(s) 148, 237
TaaI ACNGT 1 cut(s) 196
TaqI TCGA 2 cut(s) 75, 99
TatI WGTACW 1 cut(s) 135
TfiI GAWTC 1 cut(s) 262
Tru1I TTAA 1 cut(s) 304
Tru9I TTAA 1 cut(s) 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.