Rmu_sc0001563.1_g000009

Cysteine proteinase inhibitor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001563.1
Physical Location & Seq
Forward (+)
38473 .. 38839
367 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001563.1_g000009.1.cds

Sequence Viewer

Length: 291 bp
atggccgccgtcgttggaggaatccacgaatcccaaagttccgagaacagcctcgaaatcgaagacctcgctcgcttcgccgtccaagagcacaacaccaaggagaatgctgtgcttgagtttgtgagggttgtgaagaccaagcaacaagtggtttctggcactgtgtactatctcaccattgaggccaccgatgggggtcagaagaagctttttgaggccaaggtctgggttaagccttggctcaacttcaaggaagtccaggaattcaaacccgttgctgacgtctag

Protein Analysis

96

Amino Acids

10.81

Weight (kDa)

5.35

Isoelectric Point (pI)

39.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 288
AccB7I CCANNNNNTGG 1 cut(s) 228
AciI CCGC 1 cut(s) 6
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 266
AcyI GRCGYC 1 cut(s) 285
AfaI GTAC 1 cut(s) 170
AfiI CCNNNNNNNGG 2 cut(s) 195, 228
AgsI TTSAA 2 cut(s) 253, 271
AjnI CCWGG 1 cut(s) 261
AluBI AGCT 1 cut(s) 211
AluI AGCT 1 cut(s) 211
Alw21I GWGCWC 1 cut(s) 93
AoxI GGCC 3 cut(s) 3, 186, 219
ApoI RAATTY 1 cut(s) 266
AsuHPI GGTGA 1 cut(s) 169
BbsI GAAGAC 2 cut(s) 69, 143
Bbv12I GWGCWC 1 cut(s) 93
BccI CCATC 1 cut(s) 188
BceAI ACGGC 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 263
BfaI CTAG 1 cut(s) 289
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 263
BmrFI CCNGG 1 cut(s) 263
BpiI GAAGAC 2 cut(s) 69, 143
BpuEI CTTGAG 1 cut(s) 137
BsaHI GRCGYC 1 cut(s) 285
BsaJI CCNNGG 3 cut(s) 99, 222, 239
Bsc4I CCNNNNNNNGG 2 cut(s) 195, 228
BseBI CCWGG 1 cut(s) 263
BseDI CCNNGG 3 cut(s) 99, 222, 239
BseLI CCNNNNNNNGG 2 cut(s) 195, 228
BshFI GGCC 3 cut(s) 5, 188, 221
BsiHKAI GWGCWC 1 cut(s) 93
BslI CCNNNNNNNGG 2 cut(s) 195, 228
BsmI GAATGC 1 cut(s) 112
BsnI GGCC 3 cut(s) 5, 188, 221
Bsp1286I GDGCHC 1 cut(s) 93
BspACI CCGC 1 cut(s) 6
BspANI GGCC 3 cut(s) 5, 188, 221
BssECI CCNNGG 3 cut(s) 99, 222, 239
BssNI GRCGYC 1 cut(s) 285
BssT1I CCWWGG 3 cut(s) 99, 222, 239
Bst2UI CCWGG 1 cut(s) 263
Bst4CI ACNGT 1 cut(s) 166
BstACI GRCGYC 1 cut(s) 285
BstC8I GCNNGC 1 cut(s) 73
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNI CCWGG 1 cut(s) 263
BstSCI CCNGG 1 cut(s) 261
BstV2I GAAGAC 2 cut(s) 69, 143
BsuRI GGCC 3 cut(s) 5, 188, 221
BtsIMutI CAGTG 1 cut(s) 162
Cac8I GCNNGC 1 cut(s) 73
Csp6I GTAC 1 cut(s) 169
CviJI RGCY 7 cut(s) 5, 51, 188, 211, 221, 238, 244
CviKI_1 RGCY 7 cut(s) 5, 51, 188, 211, 221, 238, 244
CviQI GTAC 1 cut(s) 169
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 3 cut(s) 99, 222, 239
EcoRI GAATTC 1 cut(s) 266
EcoRII CCWGG 1 cut(s) 261
EcoT14I CCWWGG 3 cut(s) 99, 222, 239
ErhI CCWWGG 3 cut(s) 99, 222, 239
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 1 cut(s) 289
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 3 cut(s) 5, 188, 221
Hin1I GRCGYC 1 cut(s) 285
HindIII AAGCTT 1 cut(s) 209
HinfI GANTC 2 cut(s) 21, 29
HphI GGTGA 1 cut(s) 169
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 2 cut(s) 43, 204
Hpy8I GTNNAC 1 cut(s) 169
Hpy99I CGWCG 1 cut(s) 14
HpyCH4III ACNGT 1 cut(s) 166
HpyCH4IV ACGT 1 cut(s) 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpySE526I ACGT 1 cut(s) 285
Hsp92I GRCGYC 1 cut(s) 285
LpnPI CCDG 4 cut(s) 144, 214, 248, 275
MaeI CTAG 1 cut(s) 289
MaeII ACGT 1 cut(s) 285
MboII GAAGA 3 cut(s) 74, 148, 217
MhlI GDGCHC 1 cut(s) 93
MluCI AATT 1 cut(s) 266
MnlI CCTC 6 cut(s) 11, 62, 77, 120, 178, 211
MseI TTAA 1 cut(s) 234
MspR9I CCNGG 1 cut(s) 263
Mva1269I GAATGC 1 cut(s) 112
MvaI CCWGG 1 cut(s) 263
MwoI GCNNNNNNNGC 1 cut(s) 77
PctI GAATGC 1 cut(s) 112
PfeI GAWTC 2 cut(s) 21, 29
PflMI CCANNNNNTGG 1 cut(s) 228
PfoI TCCNGGA 1 cut(s) 261
PkrI GCNGC 1 cut(s) 7
Psp6I CCWGG 1 cut(s) 261
PspGI CCWGG 1 cut(s) 261
RsaI GTAC 1 cut(s) 170
RsaNI GTAC 1 cut(s) 169
SaqAI TTAA 1 cut(s) 234
SatI GCNGC 1 cut(s) 6
ScrFI CCNGG 1 cut(s) 263
SduI GDGCHC 1 cut(s) 93
SetI ASST 4 cut(s) 69, 213, 228, 288
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 1 cut(s) 266
SsiI CCGC 1 cut(s) 6
SspMI CTAG 1 cut(s) 289
StyD4I CCNGG 1 cut(s) 261
StyI CCWWGG 3 cut(s) 99, 222, 239
TaaI ACNGT 1 cut(s) 166
TaiI ACGT 1 cut(s) 288
TaqI TCGA 2 cut(s) 54, 60
TasI AATT 1 cut(s) 266
TatI WGTACW 1 cut(s) 168
TauI GCSGC 1 cut(s) 8
TfiI GAWTC 2 cut(s) 21, 29
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 1 cut(s) 169
TspRI CASTG 1 cut(s) 169
Van91I CCANNNNNTGG 1 cut(s) 228
XapI RAATTY 1 cut(s) 266
XcmI CCANNNNNNNNNTGG 1 cut(s) 148
XspI CTAG 1 cut(s) 289
ZraI GACGTC 1 cut(s) 286
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.