AT5G57123

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
23126874 .. 23127724
851 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G57123.1

Sequence Viewer

Length: 204 bp
ATGTGTTTGGTGTGTTTATGTGATGAGGAAGAGACAGAGTTAGGGAGACAACAAGCACCTGGATCGTGTCCTTATTGTGGAGGTAAAGTGCAAATGCTTGATGTCGAAAGAAAATGGATGTTCTGTTTCGTTCCTCTTTGTTTCAAGATCAAGAGGAAGTACTCGTGTTCTTCTTGTGATCGTCGTCTCGTTTTGTATCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.83

Weight (kDa)

8.09

Isoelectric Point (pI)

78.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017064)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G29905 AT5G57123
fragaria_vesca FvH4_4g07010
malus_domestica MD13G1240400.v1.1 MD16G1246800.v1.1
prunus_persica Prupe.1G073400_v2.0.a1
pyrus_communis pycom13g21270
rosa_chinensis RchiOBHm_Chr4g0399141
rosa_laevigata RLG00000009296
rosa_multiflora Rmu_sc0004767.1_g000001
rosa_roxburghii Rroxscaffold_5G00344100
rosa_samantha Rh4CG100400
rosa_wichuraiana Rw4G007600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 70
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 77
AgsI TTSAA 1 cut(s) 145
AjnI CCWGG 1 cut(s) 58
Alw26I GTCTC 3 cut(s) 26, 40, 191
AlwI GGATC 1 cut(s) 70
BauI CACGAG 1 cut(s) 163
BcgI CGANNNNNNTGC 2 cut(s) 45, 79
BciT130I CCWGG 1 cut(s) 60
BcoDI GTCTC 3 cut(s) 26, 40, 191
BmcAI AGTACT 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 60
BmrFI CCNGG 1 cut(s) 60
BsaXI ACNNNNNCTCC 2 cut(s) 72, 102
Bsc4I CCNNNNNNNGG 1 cut(s) 77
BseBI CCWGG 1 cut(s) 60
BseGI GGATG 1 cut(s) 123
BseLI CCNNNNNNNGG 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 77
BsmAI GTCTC 3 cut(s) 26, 40, 191
BsmBI CGTCTC 1 cut(s) 191
Bsp143I GATC 3 cut(s) 62, 147, 178
BspPI GGATC 1 cut(s) 70
BssMI GATC 3 cut(s) 62, 147, 178
BssSI CACGAG 1 cut(s) 163
Bst2BI CACGAG 1 cut(s) 163
Bst2UI CCWGG 1 cut(s) 60
Bst6I CTCTTC 1 cut(s) 24
BstF5I GGATG 1 cut(s) 123
BstKTI GATC 3 cut(s) 65, 150, 181
BstMAI GTCTC 3 cut(s) 26, 40, 191
BstMBI GATC 3 cut(s) 62, 147, 178
BstNI CCWGG 1 cut(s) 60
BstSCI CCNGG 1 cut(s) 58
BtsCI GGATG 1 cut(s) 123
Csp6I GTAC 1 cut(s) 160
CviQI GTAC 1 cut(s) 160
DpnI GATC 3 cut(s) 64, 149, 180
DpnII GATC 3 cut(s) 62, 147, 178
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 58
Esp3I CGTCTC 1 cut(s) 191
FaiI YATR 1 cut(s) 19
FokI GGATG 1 cut(s) 130
Hpy188III TCNNGA 2 cut(s) 145, 151
Hpy99I CGWCG 1 cut(s) 186
HpyCH4V TGCA 1 cut(s) 91
Kzo9I GATC 3 cut(s) 62, 147, 178
LpnPI CCDG 2 cut(s) 45, 72
MalI GATC 3 cut(s) 64, 149, 180
MboI GATC 3 cut(s) 62, 147, 178
MboII GAAGA 2 cut(s) 41, 162
MnlI CCTC 4 cut(s) 19, 74, 144, 147
MseI TTAA 1 cut(s) 202
MspR9I CCNGG 1 cut(s) 60
MvaI CCWGG 1 cut(s) 60
NdeII GATC 3 cut(s) 62, 147, 178
Psp6I CCWGG 1 cut(s) 58
PspGI CCWGG 1 cut(s) 58
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
SaqAI TTAA 1 cut(s) 202
Sau3AI GATC 3 cut(s) 62, 147, 178
ScaI AGTACT 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 60
SetI ASST 2 cut(s) 61, 85
StyD4I CCNGG 1 cut(s) 58
TaqI TCGA 1 cut(s) 105
TatI WGTACW 1 cut(s) 159
Tru1I TTAA 1 cut(s) 202
Tru9I TTAA 1 cut(s) 202
ZrmI AGTACT 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.