AT5G57860

Ubiquitin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0005062
Physical Location & Seq
Forward (+)
23437532 .. 23439403
1872 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G57860.4

Sequence Viewer

Length: 288 bp
ATGGCTATGTATATTCGTGTGAAGCGCATGAAAACTACTTACTTTATCCAATGTGATCCAACAGAGACTGTTTTGGATGTTAAGCAAAAACTGTTTGCTCTCATTGAGCAACCAGTTAACAATCAGCGTCTGGTCTTAATGTCTACCGAAGAAGTATTAGAGGATTCGAAATCCTTAGCAGATCAGAAGGTTGAGAATGATGCAGTTGTGGCTTTGACTTTGAAGAAAGATGATAACGAGTTTGAGGATGTCAACATTGCACAGCCCACCGACTTCTCACTTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04066 ko04120 ko05200 ko05211 map04066 map04120 map05200 map05211
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

95

Amino Acids

10.9

Weight (kDa)

4.53

Isoelectric Point (pI)

50.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 5 - 64 1.7e-07 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 143
AclWI GGATC 1 cut(s) 50
AgsI TTSAA 1 cut(s) 223
Alw26I GTCTC 1 cut(s) 59
AlwI GGATC 1 cut(s) 50
AlwNI CAGNNNCTG 2 cut(s) 68, 130
AspLEI GCGC 1 cut(s) 27
AsuII TTCGAA 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 59
BmsI GCATC 1 cut(s) 190
Bpu10I CCTNAGC 1 cut(s) 175
Bpu14I TTCGAA 1 cut(s) 167
Bse1I ACTGG 1 cut(s) 113
Bse3DI GCAATG 1 cut(s) 255
BseGI GGATG 2 cut(s) 82, 253
BseMI GCAATG 1 cut(s) 255
BseNI ACTGG 1 cut(s) 113
BsmAI GTCTC 1 cut(s) 59
Bsp119I TTCGAA 1 cut(s) 167
Bsp143I GATC 2 cut(s) 55, 181
BspHI TCATGA 1 cut(s) 284
BspPI GGATC 1 cut(s) 50
BspT104I TTCGAA 1 cut(s) 167
BsrDI GCAATG 1 cut(s) 255
BsrI ACTGG 1 cut(s) 113
BssMI GATC 2 cut(s) 55, 181
Bst4CI ACNGT 2 cut(s) 70, 93
BstBI TTCGAA 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 175
BstF5I GGATG 2 cut(s) 82, 253
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 2 cut(s) 58, 184
BstMAI GTCTC 1 cut(s) 59
BstMBI GATC 2 cut(s) 55, 181
BstMWI GCNNNNNNNGC 1 cut(s) 209
BtsCI GGATG 2 cut(s) 82, 253
CaiI CAGNNNCTG 2 cut(s) 68, 130
CciI TCATGA 1 cut(s) 284
CfoI GCGC 1 cut(s) 27
CseI GACGC 1 cut(s) 116
CviAII CATG 2 cut(s) 28, 285
CviJI RGCY 3 cut(s) 5, 212, 265
CviKI_1 RGCY 3 cut(s) 5, 212, 265
DdeI CTNAG 1 cut(s) 175
DpnI GATC 2 cut(s) 57, 183
DpnII GATC 2 cut(s) 55, 181
FaeI CATG 2 cut(s) 31, 288
FaiI YATR 4 cut(s) 8, 12, 29, 286
FatI CATG 2 cut(s) 27, 284
FblI GTMKAC 1 cut(s) 143
FokI GGATG 2 cut(s) 89, 260
GlaI GCGC 1 cut(s) 26
HgaI GACGC 1 cut(s) 116
HhaI GCGC 1 cut(s) 27
Hin1II CATG 2 cut(s) 31, 288
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HincII GTYRAC 2 cut(s) 118, 253
HindII GTYRAC 2 cut(s) 118, 253
HinfI GANTC 1 cut(s) 164
HpaI GTTAAC 1 cut(s) 118
Hpy166II GTNNAC 3 cut(s) 118, 144, 253
Hpy188I TCNGA 1 cut(s) 186
Hpy188III TCNNGA 1 cut(s) 285
Hpy8I GTNNAC 3 cut(s) 118, 144, 253
HpyAV CCTTC 1 cut(s) 181
HpyCH4III ACNGT 2 cut(s) 70, 93
HpyCH4V TGCA 2 cut(s) 203, 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 209
HpyF3I CTNAG 1 cut(s) 175
Hsp92II CATG 2 cut(s) 31, 288
HspAI GCGC 1 cut(s) 25
KspAI GTTAAC 1 cut(s) 118
Kzo9I GATC 2 cut(s) 55, 181
LpnPI CCDG 2 cut(s) 116, 126
LweI GCATC 1 cut(s) 190
MalI GATC 2 cut(s) 57, 183
MboI GATC 2 cut(s) 55, 181
MboII GAAGA 2 cut(s) 161, 235
MmeI TCCRAC 1 cut(s) 83
MnlI CCTC 2 cut(s) 154, 238
MseI TTAA 3 cut(s) 81, 117, 137
MslI CAYNNNNRTG 1 cut(s) 283
MwoI GCNNNNNNNGC 1 cut(s) 209
NdeII GATC 2 cut(s) 55, 181
NlaIII CATG 2 cut(s) 31, 288
NspV TTCGAA 1 cut(s) 167
PagI TCATGA 1 cut(s) 284
PfeI GAWTC 1 cut(s) 164
PstNI CAGNNNCTG 2 cut(s) 68, 130
RseI CAYNNNNRTG 1 cut(s) 283
SaqAI TTAA 3 cut(s) 81, 117, 137
Sau3AI GATC 2 cut(s) 55, 181
SetI ASST 1 cut(s) 192
SfaNI GCATC 1 cut(s) 190
SfuI TTCGAA 1 cut(s) 167
SgeI CNNG 5 cut(s) 29, 40, 125, 143, 250
SmiMI CAYNNNNRTG 1 cut(s) 283
TaaI ACNGT 2 cut(s) 70, 93
TaqI TCGA 1 cut(s) 167
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 3 cut(s) 81, 117, 137
Tru9I TTAA 3 cut(s) 81, 117, 137
TspDTI ATGAA 2 cut(s) 44, 273
XmiI GTMKAC 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.