Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2D

Orthogroup ID

OG0005062

Physical Location & Seq

Genomic Coordinates Forward (+)

531282 .. 534393

Gene Structure 3112 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2DG009100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 309 bp

ATGTATATCCGTGTTAAGCGTAGTAAGACAACTTACTTTATCCAGTGTGAACCAACCGAGACAATTTTAGATATTAAGCAGAAATTGCAAAATCTTATTGATCAACCGGTAAATGATCAGCGCTTGATCCTAGTCAGTACTGGGGAAGTACTGGAAGATTCAAAGACATTGGCAGATCAAAAGGTGGAAAATGATAGCGTTGTAGCACTGACCATGAGAAAAGGTCAAGTCTCTTATCCTTTTGTTTTTTGGCCCTCGTACTCATATAATAGCTGGTATTTTGGTTTAGTTGCTTGTACTGGTATATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04066 ko04120 ko05200 ko05211 map04066 map04120 map05200 map05211

Pfam Domains

Protein Families

ubiquitin

Protein Analysis

102

Amino Acids

11.78

Weight (kDa)

6.18

Isoelectric Point (pI)

44.83

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
ubiquitin	PF00240	3 - 73	7e-13	Ubiquitin family
Rad60-SLD	PF11976	8 - 68	5.9e-06	Ubiquitin-2 like Rad60 SUMO-like

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005062)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G57860 AT5G57860 AT5G57860 AT5G57860
fragaria_vesca	FvH4_1g00640 FvH4_1g00640
malus_domestica	MD02G1005200.v1.1 MD15G1149500.v1.1
prunus_persica	Prupe.7G265800_v2.0.a1 Prupe.7G265800_v2.0.a1 Prupe.7G265800_v2.0.a1 Prupe.7G265800_v2.0.a1 Prupe.7G265800_v2.0.a1 Prupe.7G265800_v2.0.a1 Prupe.7G265800_v2.0.a1 Prupe.7G265800_v2.0.a1 Prupe.7G265800_v2.0.a1
pyrus_communis	pycom02g00400 pycom15g13360
rosa_chinensis	RchiOBHm_Chr2g0085261
rosa_laevigata	RLG00000015672
rosa_multiflora	Rmu_sc0008510.1_g000006
rosa_roxburghii	Rroxscaffold_2G00155510
rosa_rugosa	Rorug01G0458600 Rorug01G0458700
rosa_samantha	Rh2AG007400 Rh2BG008000 Rh2CG008800 Rh2DG009100
rosa_wichuraiana	Rw2G000700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	121
AfaI	GTAC	4 cut(s)	139, 150, 260, 298
AfeI	AGCGCT	1 cut(s)	122
AgeI	ACCGGT	1 cut(s)	106
AgsI	TTSAA	1 cut(s)	162
AluBI	AGCT	1 cut(s)	273
AluI	AGCT	1 cut(s)	273
Alw26I	GTCTC	2 cut(s)	53, 235
AlwI	GGATC	1 cut(s)	121
Aor51HI	AGCGCT	1 cut(s)	122
AoxI	GGCC	1 cut(s)	251
AsiGI	ACCGGT	1 cut(s)	106
AspLEI	GCGC	1 cut(s)	123
AspS9I	GGNCC	1 cut(s)	252
BclI	TGATCA	2 cut(s)	100, 115
BcoDI	GTCTC	2 cut(s)	53, 235
BfaI	CTAG	1 cut(s)	131
BfoI	RGCGCY	1 cut(s)	124
BmcAI	AGTACT	2 cut(s)	139, 150
BmgT120I	GGNCC	1 cut(s)	252
BmrI	ACTGGG	1 cut(s)	150
BmuI	ACTGGG	1 cut(s)	150
BsaWI	WCCGGW	1 cut(s)	106
Bse118I	RCCGGY	1 cut(s)	106
Bse1I	ACTGG	4 cut(s)	43, 145, 156, 304
BseNI	ACTGG	4 cut(s)	43, 145, 156, 304
BshFI	GGCC	1 cut(s)	253
BshTI	ACCGGT	1 cut(s)	106
BsiSI	CCGG	1 cut(s)	107
BsmAI	GTCTC	2 cut(s)	53, 235
BsnI	GGCC	1 cut(s)	253
Bsp143I	GATC	4 cut(s)	100, 115, 126, 175
BspANI	GGCC	1 cut(s)	253
BspPI	GGATC	1 cut(s)	121
BsrFI	RCCGGY	1 cut(s)	106
BsrI	ACTGG	4 cut(s)	43, 145, 156, 304
BssAI	RCCGGY	1 cut(s)	106
BssMI	GATC	4 cut(s)	100, 115, 126, 175
BstAPI	GCANNNNNTGC	1 cut(s)	85
BstH2I	RGCGCY	1 cut(s)	124
BstHHI	GCGC	1 cut(s)	123
BstKTI	GATC	4 cut(s)	103, 118, 129, 178
BstMAI	GTCTC	2 cut(s)	53, 235
BstMBI	GATC	4 cut(s)	100, 115, 126, 175
BstMWI	GCNNNNNNNGC	1 cut(s)	85
BsuRI	GGCC	1 cut(s)	253
BtsIMutI	CAGTG	2 cut(s)	50, 206
CfoI	GCGC	1 cut(s)	123
Cfr10I	RCCGGY	1 cut(s)	106
Cfr13I	GGNCC	1 cut(s)	252
Csp6I	GTAC	4 cut(s)	138, 149, 259, 297
CspAI	ACCGGT	1 cut(s)	106
CviAII	CATG	1 cut(s)	214
CviJI	RGCY	2 cut(s)	253, 273
CviKI_1	RGCY	2 cut(s)	253, 273
CviQI	GTAC	4 cut(s)	138, 149, 259, 297
DpnI	GATC	4 cut(s)	102, 117, 128, 177
DpnII	GATC	4 cut(s)	100, 115, 126, 175
Eco47III	AGCGCT	1 cut(s)	122
FaeI	CATG	1 cut(s)	217
FaiI	YATR	6 cut(s)	6, 215, 265, 267, 305, 307
FatI	CATG	1 cut(s)	213
FbaI	TGATCA	2 cut(s)	100, 115
FspBI	CTAG	1 cut(s)	131
GlaI	GCGC	1 cut(s)	122
HaeII	RGCGCY	1 cut(s)	124
HaeIII	GGCC	1 cut(s)	253
HapII	CCGG	1 cut(s)	107
HhaI	GCGC	1 cut(s)	123
Hin1II	CATG	1 cut(s)	217
Hin6I	GCGC	1 cut(s)	121
HinP1I	GCGC	1 cut(s)	121
HinfI	GANTC	1 cut(s)	158
HpaII	CCGG	1 cut(s)	107
Hpy166II	GTNNAC	1 cut(s)	50
Hpy8I	GTNNAC	1 cut(s)	50
HpyCH4V	TGCA	1 cut(s)	88
HpyF10VI	GCNNNNNNNGC	1 cut(s)	85
Hsp92II	CATG	1 cut(s)	217
HspAI	GCGC	1 cut(s)	121
Ksp22I	TGATCA	2 cut(s)	100, 115
Kzo9I	GATC	4 cut(s)	100, 115, 126, 175
LpnPI	CCDG	6 cut(s)	56, 120, 126, 137, 259, 285
MaeI	CTAG	1 cut(s)	131
MalI	GATC	4 cut(s)	102, 117, 128, 177
MboI	GATC	4 cut(s)	100, 115, 126, 175
MboII	GAAGA	1 cut(s)	167
MluCI	AATT	2 cut(s)	63, 83
MnlI	CCTC	1 cut(s)	265
MseI	TTAA	2 cut(s)	15, 75
MspI	CCGG	1 cut(s)	107
MwoI	GCNNNNNNNGC	1 cut(s)	85
NdeII	GATC	4 cut(s)	100, 115, 126, 175
NlaIII	CATG	1 cut(s)	217
PfeI	GAWTC	1 cut(s)	158
PinAI	ACCGGT	1 cut(s)	106
PspPI	GGNCC	1 cut(s)	252
RsaI	GTAC	4 cut(s)	139, 150, 260, 298
RsaNI	GTAC	4 cut(s)	138, 149, 259, 297
SaqAI	TTAA	2 cut(s)	15, 75
Sau3AI	GATC	4 cut(s)	100, 115, 126, 175
Sau96I	GGNCC	1 cut(s)	252
ScaI	AGTACT	2 cut(s)	139, 150
SetI	ASST	3 cut(s)	186, 226, 275
Sse9I	AATT	2 cut(s)	63, 83
SspMI	CTAG	1 cut(s)	131
TasI	AATT	2 cut(s)	63, 83
TatI	WGTACW	3 cut(s)	137, 148, 296
TfiI	GAWTC	1 cut(s)	158
Tru1I	TTAA	2 cut(s)	15, 75
Tru9I	TTAA	2 cut(s)	15, 75
TscAI	CASTG	2 cut(s)	50, 213
TspRI	CASTG	2 cut(s)	50, 213
XspI	CTAG	1 cut(s)	131
ZrmI	AGTACT	2 cut(s)	139, 150

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.