Rmu_sc0008510.1_g000006

Transcription elongation factor B polypeptide

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008510.1
Physical Location & Seq
Forward (+)
26741 .. 28135
1395 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008510.1_g000006.1.cds

Sequence Viewer

Length: 306 bp
atgtatatccgtgttaagcgtagtaagacaacttactttatccagtgtgaaccaaccgagacaattttagatattaagcagaaattgcaaaatcttattgatcaaccggtaaatgatcagcgcttgatcctagtcagtactggggaagtactggaagattcaaagacattggcagatcaaaaggtggaaaatgatagcgttgtagcactgaccatgagaaaagatgacgatgagtttgaagaagtgaacattgtacgaccagatgacttctaccaatctcgtgatgcagatgcaagcagttggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

101

Amino Acids

11.76

Weight (kDa)

4.43

Isoelectric Point (pI)

53.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 121
AfaI GTAC 3 cut(s) 139, 150, 255
AfeI AGCGCT 1 cut(s) 122
AgeI ACCGGT 1 cut(s) 106
AgsI TTSAA 2 cut(s) 162, 239
Alw26I GTCTC 1 cut(s) 53
AlwI GGATC 1 cut(s) 121
Aor51HI AGCGCT 1 cut(s) 122
ArsI GACNNNNNNTTYG 2 cut(s) 218, 250
AsiGI ACCGGT 1 cut(s) 106
AspLEI GCGC 1 cut(s) 123
BauI CACGAG 1 cut(s) 279
BclI TGATCA 2 cut(s) 100, 115
BcoDI GTCTC 1 cut(s) 53
BfaI CTAG 1 cut(s) 131
BfoI RGCGCY 1 cut(s) 124
BmcAI AGTACT 2 cut(s) 139, 150
BmrI ACTGGG 1 cut(s) 150
BmsI GCATC 2 cut(s) 274, 280
BmuI ACTGGG 1 cut(s) 150
BsaWI WCCGGW 1 cut(s) 106
Bse118I RCCGGY 1 cut(s) 106
Bse1I ACTGG 3 cut(s) 43, 145, 156
BseNI ACTGG 3 cut(s) 43, 145, 156
BshTI ACCGGT 1 cut(s) 106
BsiSI CCGG 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 53
Bsp143I GATC 4 cut(s) 100, 115, 126, 175
BspPI GGATC 1 cut(s) 121
BsrFI RCCGGY 1 cut(s) 106
BsrI ACTGG 3 cut(s) 43, 145, 156
BssAI RCCGGY 1 cut(s) 106
BssMI GATC 4 cut(s) 100, 115, 126, 175
BssSI CACGAG 1 cut(s) 279
Bst2BI CACGAG 1 cut(s) 279
BstAPI GCANNNNNTGC 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 295
BstH2I RGCGCY 1 cut(s) 124
BstHHI GCGC 1 cut(s) 123
BstKTI GATC 4 cut(s) 103, 118, 129, 178
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 4 cut(s) 100, 115, 126, 175
BstMWI GCNNNNNNNGC 1 cut(s) 85
BtsIMutI CAGTG 2 cut(s) 50, 206
Cac8I GCNNGC 1 cut(s) 295
CfoI GCGC 1 cut(s) 123
Cfr10I RCCGGY 1 cut(s) 106
Csp6I GTAC 3 cut(s) 138, 149, 254
CspAI ACCGGT 1 cut(s) 106
CviAII CATG 1 cut(s) 214
CviQI GTAC 3 cut(s) 138, 149, 254
DpnI GATC 4 cut(s) 102, 117, 128, 177
DpnII GATC 4 cut(s) 100, 115, 126, 175
Eco47III AGCGCT 1 cut(s) 122
FaeI CATG 1 cut(s) 217
FaiI YATR 2 cut(s) 6, 215
FatI CATG 1 cut(s) 213
FbaI TGATCA 2 cut(s) 100, 115
FspBI CTAG 1 cut(s) 131
GlaI GCGC 1 cut(s) 122
HaeII RGCGCY 1 cut(s) 124
HapII CCGG 1 cut(s) 107
HhaI GCGC 1 cut(s) 123
Hin1II CATG 1 cut(s) 217
Hin6I GCGC 1 cut(s) 121
HinP1I GCGC 1 cut(s) 121
HinfI GANTC 1 cut(s) 158
HpaII CCGG 1 cut(s) 107
Hpy166II GTNNAC 2 cut(s) 50, 247
Hpy188III TCNNGA 1 cut(s) 281
Hpy8I GTNNAC 2 cut(s) 50, 247
HpyCH4V TGCA 3 cut(s) 88, 287, 293
HpyF10VI GCNNNNNNNGC 1 cut(s) 85
Hsp92II CATG 1 cut(s) 217
HspAI GCGC 1 cut(s) 121
Ksp22I TGATCA 2 cut(s) 100, 115
Kzo9I GATC 4 cut(s) 100, 115, 126, 175
LpnPI CCDG 5 cut(s) 56, 120, 126, 137, 273
LweI GCATC 2 cut(s) 274, 280
MaeI CTAG 1 cut(s) 131
MalI GATC 4 cut(s) 102, 117, 128, 177
MboI GATC 4 cut(s) 100, 115, 126, 175
MboII GAAGA 2 cut(s) 167, 251
MluCI AATT 2 cut(s) 63, 83
MseI TTAA 2 cut(s) 15, 75
MspI CCGG 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 85
NdeII GATC 4 cut(s) 100, 115, 126, 175
NlaIII CATG 1 cut(s) 217
PfeI GAWTC 1 cut(s) 158
PinAI ACCGGT 1 cut(s) 106
RsaI GTAC 3 cut(s) 139, 150, 255
RsaNI GTAC 3 cut(s) 138, 149, 254
SaqAI TTAA 2 cut(s) 15, 75
Sau3AI GATC 4 cut(s) 100, 115, 126, 175
ScaI AGTACT 2 cut(s) 139, 150
SetI ASST 1 cut(s) 186
SfaNI GCATC 2 cut(s) 274, 280
Sse9I AATT 2 cut(s) 63, 83
SspMI CTAG 1 cut(s) 131
TasI AATT 2 cut(s) 63, 83
TatI WGTACW 2 cut(s) 137, 148
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 2 cut(s) 15, 75
Tru9I TTAA 2 cut(s) 15, 75
TscAI CASTG 2 cut(s) 50, 213
TspRI CASTG 2 cut(s) 50, 213
XspI CTAG 1 cut(s) 131
ZrmI AGTACT 2 cut(s) 139, 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.