FvH4_1g00640

Transcription elongation factor B polypeptide

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
OG0005062
Physical Location & Seq
Forward (+)
335143 .. 337290
2148 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g00640.t1

Sequence Viewer

Length: 312 bp
ATGGCCATGTATATCCGTGTTAAGCGTAGTAAGACAACGTACTTTATCCAGTGTGAACCAACTGAGACAATTTTAGATATTAAGCAGAAATTGCAAAATCTTATTGATCAATCAGTAAATGATCAGCGCTTGATCCTAGTCAGTACTGGCGCAGTACTGGATGATTCAAAGACATTGGCAGATCAGAAGGTGGAAAATGATGGCATTGTAGCACTGACCTTGAGAAAAGATGATGATGAGTTTGAAGAAGTGAACATTGTGCGACCAGATGACTTCTACCAATCTCGTGATGGAGATGCTGGCAGTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04066 ko04120 ko05200 ko05211 map04066 map04120 map05200 map05211
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

104

Amino Acids

11.8

Weight (kDa)

4.46

Isoelectric Point (pI)

50.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 5 - 76 8.2e-11 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 127
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 3 cut(s) 41, 145, 156
AfeI AGCGCT 1 cut(s) 128
AgsI TTSAA 2 cut(s) 168, 245
Alw26I GTCTC 1 cut(s) 59
AlwI GGATC 1 cut(s) 127
Aor51HI AGCGCT 1 cut(s) 128
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 2 cut(s) 129, 152
BalI TGGCCA 1 cut(s) 5
BauI CACGAG 1 cut(s) 285
BccI CCATC 2 cut(s) 194, 284
BclI TGATCA 2 cut(s) 106, 121
BcoDI GTCTC 1 cut(s) 59
BfaI CTAG 1 cut(s) 137
BfoI RGCGCY 1 cut(s) 130
BmcAI AGTACT 2 cut(s) 145, 156
BmsI GCATC 1 cut(s) 286
BpuEI CTTGAG 1 cut(s) 241
Bse1I ACTGG 3 cut(s) 49, 151, 162
BseGI GGATG 1 cut(s) 166
BseMII CTCAG 1 cut(s) 54
BseNI ACTGG 3 cut(s) 49, 151, 162
BshFI GGCC 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 59
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 4 cut(s) 106, 121, 132, 181
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 55
BspPI GGATC 1 cut(s) 127
BsrI ACTGG 3 cut(s) 49, 151, 162
BssMI GATC 4 cut(s) 106, 121, 132, 181
BssSI CACGAG 1 cut(s) 285
Bst2BI CACGAG 1 cut(s) 285
BstAPI GCANNNNNTGC 1 cut(s) 91
BstC8I GCNNGC 1 cut(s) 301
BstDEI CTNAG 1 cut(s) 63
BstF5I GGATG 1 cut(s) 166
BstH2I RGCGCY 1 cut(s) 130
BstHHI GCGC 2 cut(s) 129, 152
BstKTI GATC 4 cut(s) 109, 124, 135, 184
BstMAI GTCTC 1 cut(s) 59
BstMBI GATC 4 cut(s) 106, 121, 132, 181
BstMWI GCNNNNNNNGC 1 cut(s) 91
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 166
BtsIMutI CAGTG 2 cut(s) 56, 212
Cac8I GCNNGC 1 cut(s) 301
CfoI GCGC 2 cut(s) 129, 152
Csp6I GTAC 3 cut(s) 40, 144, 155
CviAII CATG 1 cut(s) 7
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 3 cut(s) 40, 144, 155
DdeI CTNAG 1 cut(s) 63
DpnI GATC 4 cut(s) 108, 123, 134, 183
DpnII GATC 4 cut(s) 106, 121, 132, 181
EaeI YGGCCR 1 cut(s) 3
Eco47III AGCGCT 1 cut(s) 128
FaeI CATG 1 cut(s) 10
FaiI YATR 2 cut(s) 8, 12
FatI CATG 1 cut(s) 6
FbaI TGATCA 2 cut(s) 106, 121
FokI GGATG 1 cut(s) 173
FspBI CTAG 1 cut(s) 137
GlaI GCGC 2 cut(s) 128, 151
HaeII RGCGCY 1 cut(s) 130
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 2 cut(s) 129, 152
Hin1II CATG 1 cut(s) 10
Hin6I GCGC 2 cut(s) 127, 150
HinP1I GCGC 2 cut(s) 127, 150
HinfI GANTC 1 cut(s) 164
Hpy166II GTNNAC 2 cut(s) 56, 253
Hpy188I TCNGA 1 cut(s) 186
Hpy188III TCNNGA 1 cut(s) 287
Hpy8I GTNNAC 2 cut(s) 56, 253
HpyAV CCTTC 1 cut(s) 181
HpyCH4IV ACGT 1 cut(s) 38
HpyCH4V TGCA 1 cut(s) 94
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 63
HpySE526I ACGT 1 cut(s) 38
Hsp92II CATG 1 cut(s) 10
HspAI GCGC 2 cut(s) 127, 150
Ksp22I TGATCA 2 cut(s) 106, 121
Kzo9I GATC 4 cut(s) 106, 121, 132, 181
LpnPI CCDG 5 cut(s) 62, 132, 143, 279, 285
LweI GCATC 1 cut(s) 286
MaeI CTAG 1 cut(s) 137
MaeII ACGT 1 cut(s) 38
MalI GATC 4 cut(s) 108, 123, 134, 183
MboI GATC 4 cut(s) 106, 121, 132, 181
MboII GAAGA 1 cut(s) 257
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 69, 89
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 21, 81
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 91
NdeII GATC 4 cut(s) 106, 121, 132, 181
NlaIII CATG 1 cut(s) 10
PfeI GAWTC 1 cut(s) 164
RsaI GTAC 3 cut(s) 41, 145, 156
RsaNI GTAC 3 cut(s) 40, 144, 155
SaqAI TTAA 2 cut(s) 21, 81
Sau3AI GATC 4 cut(s) 106, 121, 132, 181
ScaI AGTACT 2 cut(s) 145, 156
SetI ASST 3 cut(s) 41, 192, 221
SfaNI GCATC 1 cut(s) 286
SmlI CTYRAG 1 cut(s) 220
SmoI CTYRAG 1 cut(s) 220
Sse9I AATT 2 cut(s) 69, 89
SspMI CTAG 1 cut(s) 137
TaiI ACGT 1 cut(s) 41
TasI AATT 2 cut(s) 69, 89
TatI WGTACW 2 cut(s) 143, 154
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 2 cut(s) 21, 81
Tru9I TTAA 2 cut(s) 21, 81
TscAI CASTG 2 cut(s) 56, 219
TspGWI ACGGA 1 cut(s) 5
TspRI CASTG 2 cut(s) 56, 219
XcmI CCANNNNNNNNNTGG 1 cut(s) 287
XspI CTAG 1 cut(s) 137
ZrmI AGTACT 2 cut(s) 145, 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.