Rh2BG008000

Transcription elongation factor B polypeptide

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
568341 .. 570342
2002 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG008000.1

Sequence Viewer

Length: 312 bp
ATGGCCATGTATATCCGTGTTAAGCGTAGTAAGACAACTTACTTTATCCAGTGTGAACCAACCGAGACAATTTTAGATATTAAGCAGAAATTGCAAAATCTTATTGATCAACCGGTAAATGATCAGCGCTTGATCCTAGTCAGTACTGGGGAAGTACTGGAAGATTCAAAGACATTGGCAGATCAAAAGGTGGAAAATGATGGCGTTGTAGCACTGACCTTGAGAAAAGATGACGATGAGTTTGAAGAAGTGAACATTGTACGACCAGATGACTTCTACCAATCTCGTGATGCAGATGCAAGCAGTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.91

Weight (kDa)

4.43

Isoelectric Point (pI)

54.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 5 - 76 2.4e-12 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 127
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 3 cut(s) 145, 156, 261
AfeI AGCGCT 1 cut(s) 128
AgeI ACCGGT 1 cut(s) 112
AgsI TTSAA 2 cut(s) 168, 245
Alw26I GTCTC 1 cut(s) 59
AlwI GGATC 1 cut(s) 127
Aor51HI AGCGCT 1 cut(s) 128
AoxI GGCC 1 cut(s) 3
ArsI GACNNNNNNTTYG 2 cut(s) 224, 256
AsiGI ACCGGT 1 cut(s) 112
AspLEI GCGC 1 cut(s) 129
BalI TGGCCA 1 cut(s) 5
BauI CACGAG 1 cut(s) 285
BccI CCATC 1 cut(s) 194
BclI TGATCA 2 cut(s) 106, 121
BcoDI GTCTC 1 cut(s) 59
BfaI CTAG 1 cut(s) 137
BfoI RGCGCY 1 cut(s) 130
BmcAI AGTACT 2 cut(s) 145, 156
BmrI ACTGGG 1 cut(s) 156
BmsI GCATC 2 cut(s) 280, 286
BmuI ACTGGG 1 cut(s) 156
BpuEI CTTGAG 1 cut(s) 241
BsaWI WCCGGW 1 cut(s) 112
Bse118I RCCGGY 1 cut(s) 112
Bse1I ACTGG 3 cut(s) 49, 151, 162
BseNI ACTGG 3 cut(s) 49, 151, 162
BshFI GGCC 1 cut(s) 5
BshTI ACCGGT 1 cut(s) 112
BsiSI CCGG 1 cut(s) 113
BsmAI GTCTC 1 cut(s) 59
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 4 cut(s) 106, 121, 132, 181
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 127
BsrFI RCCGGY 1 cut(s) 112
BsrI ACTGG 3 cut(s) 49, 151, 162
BssAI RCCGGY 1 cut(s) 112
BssMI GATC 4 cut(s) 106, 121, 132, 181
BssSI CACGAG 1 cut(s) 285
Bst2BI CACGAG 1 cut(s) 285
BstAPI GCANNNNNTGC 1 cut(s) 91
BstC8I GCNNGC 1 cut(s) 301
BstH2I RGCGCY 1 cut(s) 130
BstHHI GCGC 1 cut(s) 129
BstKTI GATC 4 cut(s) 109, 124, 135, 184
BstMAI GTCTC 1 cut(s) 59
BstMBI GATC 4 cut(s) 106, 121, 132, 181
BstMWI GCNNNNNNNGC 1 cut(s) 91
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 2 cut(s) 56, 212
Cac8I GCNNGC 1 cut(s) 301
CfoI GCGC 1 cut(s) 129
Cfr10I RCCGGY 1 cut(s) 112
Csp6I GTAC 3 cut(s) 144, 155, 260
CspAI ACCGGT 1 cut(s) 112
CviAII CATG 1 cut(s) 7
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
CviQI GTAC 3 cut(s) 144, 155, 260
DpnI GATC 4 cut(s) 108, 123, 134, 183
DpnII GATC 4 cut(s) 106, 121, 132, 181
EaeI YGGCCR 1 cut(s) 3
Eco47III AGCGCT 1 cut(s) 128
FaeI CATG 1 cut(s) 10
FaiI YATR 2 cut(s) 8, 12
FatI CATG 1 cut(s) 6
FbaI TGATCA 2 cut(s) 106, 121
FspBI CTAG 1 cut(s) 137
GlaI GCGC 1 cut(s) 128
HaeII RGCGCY 1 cut(s) 130
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 113
HhaI GCGC 1 cut(s) 129
Hin1II CATG 1 cut(s) 10
Hin6I GCGC 1 cut(s) 127
HinP1I GCGC 1 cut(s) 127
HinfI GANTC 1 cut(s) 164
HpaII CCGG 1 cut(s) 113
Hpy166II GTNNAC 2 cut(s) 56, 253
Hpy188III TCNNGA 1 cut(s) 287
Hpy8I GTNNAC 2 cut(s) 56, 253
HpyCH4V TGCA 3 cut(s) 94, 293, 299
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
Hsp92II CATG 1 cut(s) 10
HspAI GCGC 1 cut(s) 127
Ksp22I TGATCA 2 cut(s) 106, 121
Kzo9I GATC 4 cut(s) 106, 121, 132, 181
LpnPI CCDG 5 cut(s) 62, 126, 132, 143, 279
LweI GCATC 2 cut(s) 280, 286
MaeI CTAG 1 cut(s) 137
MalI GATC 4 cut(s) 108, 123, 134, 183
MboI GATC 4 cut(s) 106, 121, 132, 181
MboII GAAGA 2 cut(s) 173, 257
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 69, 89
MluNI TGGCCA 1 cut(s) 5
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 21, 81
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 91
NdeII GATC 4 cut(s) 106, 121, 132, 181
NlaIII CATG 1 cut(s) 10
PfeI GAWTC 1 cut(s) 164
PinAI ACCGGT 1 cut(s) 112
RsaI GTAC 3 cut(s) 145, 156, 261
RsaNI GTAC 3 cut(s) 144, 155, 260
SaqAI TTAA 2 cut(s) 21, 81
Sau3AI GATC 4 cut(s) 106, 121, 132, 181
ScaI AGTACT 2 cut(s) 145, 156
SetI ASST 2 cut(s) 192, 221
SfaNI GCATC 2 cut(s) 280, 286
SmlI CTYRAG 1 cut(s) 220
SmoI CTYRAG 1 cut(s) 220
Sse9I AATT 2 cut(s) 69, 89
SspMI CTAG 1 cut(s) 137
TasI AATT 2 cut(s) 69, 89
TatI WGTACW 2 cut(s) 143, 154
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 2 cut(s) 21, 81
Tru9I TTAA 2 cut(s) 21, 81
TscAI CASTG 2 cut(s) 56, 219
TspGWI ACGGA 1 cut(s) 5
TspRI CASTG 2 cut(s) 56, 219
XspI CTAG 1 cut(s) 137
ZrmI AGTACT 2 cut(s) 145, 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.