Rh2CG008800

Transcription elongation factor B polypeptide

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
756371 .. 759436
3066 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG008800.1

Sequence Viewer

Length: 228 bp
ATGTATATCCGTGTTAAGCGTAGTAAGACAACTTACTTTATCCAGTGTGAACCAACCGAGACAATTTTAGATATTAAGCAGAAATTGCAAAATCTTATTGATCAACCGGTAAATGATCAGCGCTTGATCCTAGTCAGTACTGGGGAAGTACTGGAAGATTCAAAGACGTTGGCAGATCAAAAGGTGGAAAATGATGGCGTTGTAGCACTGACTTTGAGAAAAGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.56

Weight (kDa)

6.19

Isoelectric Point (pI)

44.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 3 - 74 8.3e-13 Ubiquitin family
Rad60-SLD PF11976 8 - 68 5.5e-06 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 121
AfaI GTAC 2 cut(s) 139, 150
AfeI AGCGCT 1 cut(s) 122
AgeI ACCGGT 1 cut(s) 106
AgsI TTSAA 1 cut(s) 162
Alw26I GTCTC 1 cut(s) 53
AlwI GGATC 1 cut(s) 121
Aor51HI AGCGCT 1 cut(s) 122
AsiGI ACCGGT 1 cut(s) 106
AspLEI GCGC 1 cut(s) 123
BccI CCATC 1 cut(s) 188
BclI TGATCA 2 cut(s) 100, 115
BcoDI GTCTC 1 cut(s) 53
BfaI CTAG 1 cut(s) 131
BfoI RGCGCY 1 cut(s) 124
BmcAI AGTACT 2 cut(s) 139, 150
BmrI ACTGGG 1 cut(s) 150
BmuI ACTGGG 1 cut(s) 150
BsaWI WCCGGW 1 cut(s) 106
Bse118I RCCGGY 1 cut(s) 106
Bse1I ACTGG 3 cut(s) 43, 145, 156
BseNI ACTGG 3 cut(s) 43, 145, 156
BshTI ACCGGT 1 cut(s) 106
BsiSI CCGG 1 cut(s) 107
BsmAI GTCTC 1 cut(s) 53
Bsp143I GATC 4 cut(s) 100, 115, 126, 175
BspPI GGATC 1 cut(s) 121
BsrFI RCCGGY 1 cut(s) 106
BsrI ACTGG 3 cut(s) 43, 145, 156
BssAI RCCGGY 1 cut(s) 106
BssMI GATC 4 cut(s) 100, 115, 126, 175
BstAPI GCANNNNNTGC 1 cut(s) 85
BstH2I RGCGCY 1 cut(s) 124
BstHHI GCGC 1 cut(s) 123
BstKTI GATC 4 cut(s) 103, 118, 129, 178
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 4 cut(s) 100, 115, 126, 175
BstMWI GCNNNNNNNGC 1 cut(s) 85
BtsIMutI CAGTG 2 cut(s) 50, 206
CfoI GCGC 1 cut(s) 123
Cfr10I RCCGGY 1 cut(s) 106
Csp6I GTAC 2 cut(s) 138, 149
CspAI ACCGGT 1 cut(s) 106
CviQI GTAC 2 cut(s) 138, 149
DpnI GATC 4 cut(s) 102, 117, 128, 177
DpnII GATC 4 cut(s) 100, 115, 126, 175
Eco47III AGCGCT 1 cut(s) 122
FaiI YATR 1 cut(s) 6
FbaI TGATCA 2 cut(s) 100, 115
FspBI CTAG 1 cut(s) 131
GlaI GCGC 1 cut(s) 122
HaeII RGCGCY 1 cut(s) 124
HapII CCGG 1 cut(s) 107
HhaI GCGC 1 cut(s) 123
Hin6I GCGC 1 cut(s) 121
HinP1I GCGC 1 cut(s) 121
HinfI GANTC 1 cut(s) 158
HpaII CCGG 1 cut(s) 107
Hpy166II GTNNAC 1 cut(s) 50
Hpy8I GTNNAC 1 cut(s) 50
HpyCH4IV ACGT 1 cut(s) 167
HpyCH4V TGCA 1 cut(s) 88
HpyF10VI GCNNNNNNNGC 1 cut(s) 85
HpySE526I ACGT 1 cut(s) 167
HspAI GCGC 1 cut(s) 121
Ksp22I TGATCA 2 cut(s) 100, 115
Kzo9I GATC 4 cut(s) 100, 115, 126, 175
LpnPI CCDG 4 cut(s) 56, 120, 126, 137
MaeI CTAG 1 cut(s) 131
MaeII ACGT 1 cut(s) 167
MalI GATC 4 cut(s) 102, 117, 128, 177
MboI GATC 4 cut(s) 100, 115, 126, 175
MboII GAAGA 1 cut(s) 167
MluCI AATT 2 cut(s) 63, 83
MseI TTAA 2 cut(s) 15, 75
MspI CCGG 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 85
NdeII GATC 4 cut(s) 100, 115, 126, 175
PfeI GAWTC 1 cut(s) 158
PinAI ACCGGT 1 cut(s) 106
RsaI GTAC 2 cut(s) 139, 150
RsaNI GTAC 2 cut(s) 138, 149
SaqAI TTAA 2 cut(s) 15, 75
Sau3AI GATC 4 cut(s) 100, 115, 126, 175
ScaI AGTACT 2 cut(s) 139, 150
SetI ASST 3 cut(s) 170, 186, 226
SgeI CNNG 8 cut(s) 23, 55, 70, 119, 136, 143, 153, 164
Sse9I AATT 2 cut(s) 63, 83
SspMI CTAG 1 cut(s) 131
TaiI ACGT 1 cut(s) 170
TasI AATT 2 cut(s) 63, 83
TatI WGTACW 2 cut(s) 137, 148
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 2 cut(s) 15, 75
Tru9I TTAA 2 cut(s) 15, 75
TscAI CASTG 2 cut(s) 50, 213
TspRI CASTG 2 cut(s) 50, 213
XspI CTAG 1 cut(s) 131
ZrmI AGTACT 2 cut(s) 139, 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.