ATMG00490

Mitovirus RNA-dependent RNA polymerase

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Mt
Physical Location & Seq
Forward (+)
130817 .. 131140
324 bp
Loading structure...
UTR
Exon/CDS
Intron
ATMG00490.1

Sequence Viewer

Length: 324 bp
ATGGCTGTTCGCTGTAGCAAAATTCAACGAACCGACGGGCGTCCCGGACATAGCCTTCAACCCGCAAAGGTTAGCTTTGTTGCTGGACAACCACTAGGGTACTATTCTTCCTGGCCCCTCTTCGCCCTATCACATCACATGGTGGTGTGGTATGCGGCAGAACATGTCTATCCTTCCTCCTTCTTCTTTCAGTCGAAACTTCCTCCTAGTGAGGTGTTCGCCTATCCAGGTATGGAAGTATTCAATGAATACACTCTGTACCATGCATGGGTGGATGAAGCTTTATCTGGAGTATCAAAGATGGAATTGTATGCTAAGGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.12

Weight (kDa)

6.96

Isoelectric Point (pI)

42.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Mitovir_RNA_pol PF05919 22 - 58 1.5e-11 Mitovirus RNA-dependent RNA polymerase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017129)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 63, 155
AcsI RAATTY 1 cut(s) 21
AcyI GRCGYC 1 cut(s) 40
AdeI CACNNNGTG 1 cut(s) 142
AfaI GTAC 2 cut(s) 101, 260
AfiI CCNNNNNNNGG 1 cut(s) 268
AflIII ACRYGT 1 cut(s) 163
AgsI TTSAA 3 cut(s) 26, 59, 244
AjnI CCWGG 2 cut(s) 110, 226
AluBI AGCT 2 cut(s) 75, 281
AluI AGCT 2 cut(s) 75, 281
AoxI GGCC 1 cut(s) 113
ApoI RAATTY 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 114
AsuC2I CCSGG 1 cut(s) 45
BccI CCATC 1 cut(s) 295
BciT130I CCWGG 2 cut(s) 112, 228
BcnI CCSGG 1 cut(s) 45
BfaI CTAG 2 cut(s) 95, 207
BfmI CTRYAG 1 cut(s) 13
BisI GCNGC 1 cut(s) 156
BlsI GCNGC 1 cut(s) 157
Bme1390I CCNGG 3 cut(s) 45, 112, 228
BmgT120I GGNCC 1 cut(s) 114
BmiI GGNNCC 1 cut(s) 116
BmrFI CCNGG 3 cut(s) 45, 112, 228
BoxI GACNNNNGTC 1 cut(s) 39
BpmI CTGGAG 1 cut(s) 309
Bpu10I CCTNAGC 1 cut(s) 315
BpuMI CCSGG 1 cut(s) 45
BsaHI GRCGYC 1 cut(s) 40
Bsc4I CCNNNNNNNGG 1 cut(s) 268
BseBI CCWGG 2 cut(s) 112, 228
BseGI GGATG 1 cut(s) 280
BseLI CCNNNNNNNGG 1 cut(s) 268
BshFI GGCC 1 cut(s) 115
BsiSI CCGG 1 cut(s) 45
BslFI GGGAC 1 cut(s) 27
BslI CCNNNNNNNGG 1 cut(s) 268
BsmFI GGGAC 1 cut(s) 27
BsnI GGCC 1 cut(s) 115
BspACI CCGC 2 cut(s) 63, 155
BspANI GGCC 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 116
BssNI GRCGYC 1 cut(s) 40
Bst2UI CCWGG 2 cut(s) 112, 228
Bst6I CTCTTC 1 cut(s) 125
BstACI GRCGYC 1 cut(s) 40
BstDEI CTNAG 2 cut(s) 315, 321
BstF5I GGATG 1 cut(s) 280
BstNI CCWGG 2 cut(s) 112, 228
BstNSI RCATGY 1 cut(s) 167
BstPAI GACNNNNGTC 1 cut(s) 39
BstSCI CCNGG 3 cut(s) 43, 110, 226
BstSFI CTRYAG 1 cut(s) 13
BsuRI GGCC 1 cut(s) 115
BtsCI GGATG 1 cut(s) 280
Cfr13I GGNCC 1 cut(s) 114
CseI GACGC 1 cut(s) 29
Csp6I GTAC 2 cut(s) 100, 259
CviAII CATG 4 cut(s) 139, 164, 263, 267
CviJI RGCY 6 cut(s) 5, 54, 75, 115, 281, 320
CviKI_1 RGCY 6 cut(s) 5, 54, 75, 115, 281, 320
CviQI GTAC 2 cut(s) 100, 259
DdeI CTNAG 2 cut(s) 315, 321
DraIII CACNNNGTG 1 cut(s) 142
Eam1104I CTCTTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 125
EcoRII CCWGG 2 cut(s) 110, 226
EcoT22I ATGCAT 1 cut(s) 268
FaeI CATG 4 cut(s) 142, 167, 266, 270
FaiI YATR 8 cut(s) 51, 140, 153, 165, 233, 264, 268, 312
FalI AAGNNNNNCTT 2 cut(s) 59, 91
FaqI GGGAC 1 cut(s) 27
FatI CATG 4 cut(s) 138, 163, 262, 266
FauI CCCGC 1 cut(s) 70
Fnu4HI GCNGC 1 cut(s) 156
FokI GGATG 1 cut(s) 287
Fsp4HI GCNGC 1 cut(s) 156
FspBI CTAG 2 cut(s) 95, 207
GluI GCNGC 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 309
HaeIII GGCC 1 cut(s) 115
HapII CCGG 1 cut(s) 45
HgaI GACGC 1 cut(s) 29
Hin1I GRCGYC 1 cut(s) 40
Hin1II CATG 4 cut(s) 142, 167, 266, 270
HindIII AAGCTT 1 cut(s) 279
HpaII CCGG 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 288
Hpy99I CGWCG 1 cut(s) 38
HpyAV CCTTC 3 cut(s) 65, 183, 190
HpyCH4V TGCA 1 cut(s) 266
HpyF3I CTNAG 2 cut(s) 315, 321
Hsp92I GRCGYC 1 cut(s) 40
Hsp92II CATG 4 cut(s) 142, 167, 266, 270
LpnPI CCDG 7 cut(s) 58, 69, 97, 124, 213, 240, 273
MaeI CTAG 2 cut(s) 95, 207
MboII GAAGA 3 cut(s) 99, 112, 175
MluCI AATT 2 cut(s) 21, 305
MnlI CCTC 4 cut(s) 128, 187, 205, 213
Mph1103I ATGCAT 1 cut(s) 268
MslI CAYNNNNRTG 1 cut(s) 143
MspI CCGG 1 cut(s) 45
MspR9I CCNGG 3 cut(s) 45, 112, 228
MvaI CCWGG 2 cut(s) 112, 228
NciI CCSGG 1 cut(s) 45
NlaIII CATG 4 cut(s) 142, 167, 266, 270
NlaIV GGNNCC 1 cut(s) 116
NsiI ATGCAT 1 cut(s) 268
NspI RCATGY 1 cut(s) 167
PciI ACATGT 1 cut(s) 163
PfoI TCCNGGA 1 cut(s) 43
PkrI GCNGC 1 cut(s) 157
PscI ACATGT 1 cut(s) 163
PshAI GACNNNNGTC 1 cut(s) 39
Psp6I CCWGG 2 cut(s) 110, 226
PspGI CCWGG 2 cut(s) 110, 226
PspN4I GGNNCC 1 cut(s) 116
PspPI GGNCC 1 cut(s) 114
RsaI GTAC 2 cut(s) 101, 260
RsaNI GTAC 2 cut(s) 100, 259
RseI CAYNNNNRTG 1 cut(s) 143
SatI GCNGC 1 cut(s) 156
Sau96I GGNCC 1 cut(s) 114
ScrFI CCNGG 3 cut(s) 45, 112, 228
SetI ASST 5 cut(s) 72, 77, 216, 232, 283
SfcI CTRYAG 1 cut(s) 13
SmiMI CAYNNNNRTG 1 cut(s) 143
Sse9I AATT 2 cut(s) 21, 305
SsiI CCGC 2 cut(s) 63, 155
SspMI CTAG 2 cut(s) 95, 207
StyD4I CCNGG 3 cut(s) 43, 110, 226
TaqI TCGA 1 cut(s) 194
TasI AATT 2 cut(s) 21, 305
TauI GCSGC 1 cut(s) 158
TspDTI ATGAA 2 cut(s) 261, 291
XapI RAATTY 1 cut(s) 21
XceI RCATGY 1 cut(s) 167
XspI CTAG 2 cut(s) 95, 207
Zsp2I ATGCAT 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.