Rroxscaffold_2G00119420

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
51267804 .. 51273906
6103 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00119420.1

Sequence Viewer

Length: 267 bp
ATGAAGAATCTCTCCGAAATCTGCTCTTTGATCACTGATTCACCGGCCACTACCCCCTTGGAAATGTATCCCACCTTATTCTCAAACCTGGCGGCTCGGTTGATTGGCACTCCTGTAGGCTCATCTTGCATACAAATTCTGGGGGTCCCAGGTCCTGCATCCACCAAGAACTTATCTTCCCTTAAGCGTACAACTTCAGATTCTAAGGCATTTCCACTAGATAACTTAAAACTGGAATTAGATCTTGGAAATGATCGACTCATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.38

Weight (kDa)

6.1

Isoelectric Point (pI)

46.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017129)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AcoI YGGCCR 1 cut(s) 45
AcsI RAATTY 1 cut(s) 135
AcuI CTGAAG 1 cut(s) 180
AfaI GTAC 1 cut(s) 190
AflII CTTAAG 1 cut(s) 182
AjnI CCWGG 2 cut(s) 87, 148
AjuI GAANNNNNNNTTGG 2 cut(s) 228, 260
AloI GAACNNNNNNTCC 2 cut(s) 161, 193
AlwNI CAGNNNCTG 1 cut(s) 155
AoxI GGCC 1 cut(s) 45
ApoI RAATTY 1 cut(s) 135
AspS9I GGNCC 2 cut(s) 145, 152
AsuHPI GGTGA 1 cut(s) 33
AvaII GGWCC 2 cut(s) 145, 152
BciT130I CCWGG 2 cut(s) 89, 150
BciVI GTATCC 1 cut(s) 78
BclI TGATCA 1 cut(s) 30
BfaI CTAG 1 cut(s) 218
BfmI CTRYAG 1 cut(s) 114
BfrI CTTAAG 1 cut(s) 182
BfuI GTATCC 1 cut(s) 78
BglII AGATCT 1 cut(s) 241
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
Bme1390I CCNGG 2 cut(s) 89, 150
Bme18I GGWCC 2 cut(s) 145, 152
BmgT120I GGNCC 2 cut(s) 145, 152
BmiI GGNNCC 2 cut(s) 146, 147
BmrFI CCNGG 2 cut(s) 89, 150
BmsI GCATC 1 cut(s) 167
BsaJI CCNNGG 2 cut(s) 57, 148
Bse118I RCCGGY 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 237
BseBI CCWGG 2 cut(s) 89, 150
BseDI CCNNGG 2 cut(s) 57, 148
BseGI GGATG 1 cut(s) 158
BseNI ACTGG 1 cut(s) 237
BshFI GGCC 1 cut(s) 47
BsiSI CCGG 1 cut(s) 44
BslFI GGGAC 1 cut(s) 131
BsmFI GGGAC 1 cut(s) 131
BsnI GGCC 1 cut(s) 47
Bsp143I GATC 3 cut(s) 30, 241, 253
BspACI CCGC 1 cut(s) 92
BspANI GGCC 1 cut(s) 47
BspLI GGNNCC 2 cut(s) 146, 147
BspTI CTTAAG 1 cut(s) 182
BsrFI RCCGGY 1 cut(s) 43
BsrI ACTGG 1 cut(s) 237
BssAI RCCGGY 1 cut(s) 43
BssECI CCNNGG 2 cut(s) 57, 148
BssMI GATC 3 cut(s) 30, 241, 253
BssT1I CCWWGG 1 cut(s) 57
Bst2UI CCWGG 2 cut(s) 89, 150
BstAFI CTTAAG 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 204
BstF5I GGATG 1 cut(s) 158
BstKTI GATC 3 cut(s) 33, 244, 256
BstMBI GATC 3 cut(s) 30, 241, 253
BstMWI GCNNNNNNNGC 1 cut(s) 126
BstNI CCWGG 2 cut(s) 89, 150
BstSCI CCNGG 2 cut(s) 87, 148
BstSFI CTRYAG 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 241
BstYI RGATCY 1 cut(s) 241
BsuI GTATCC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 47
BtsCI GGATG 1 cut(s) 158
BtsIMutI CAGTG 1 cut(s) 33
CaiI CAGNNNCTG 1 cut(s) 155
Cfr10I RCCGGY 1 cut(s) 43
Cfr13I GGNCC 2 cut(s) 145, 152
Csp6I GTAC 1 cut(s) 189
CviJI RGCY 3 cut(s) 47, 95, 120
CviKI_1 RGCY 3 cut(s) 47, 95, 120
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 1 cut(s) 204
DpnI GATC 3 cut(s) 32, 243, 255
DpnII GATC 3 cut(s) 30, 241, 253
EaeI YGGCCR 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 57
Eco47I GGWCC 2 cut(s) 145, 152
Eco57I CTGAAG 1 cut(s) 180
EcoO109I RGGNCCY 2 cut(s) 145, 152
EcoRII CCWGG 2 cut(s) 87, 148
EcoT14I CCWWGG 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 57
FaiI YATR 3 cut(s) 131, 263, 265
FaqI GGGAC 1 cut(s) 131
FbaI TGATCA 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 93
FokI GGATG 1 cut(s) 145
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 1 cut(s) 218
GluI GCNGC 1 cut(s) 93
HaeIII GGCC 1 cut(s) 47
HapII CCGG 1 cut(s) 44
HinfI GANTC 4 cut(s) 7, 38, 200, 258
HpaII CCGG 1 cut(s) 44
HphI GGTGA 1 cut(s) 33
Hpy188I TCNGA 2 cut(s) 16, 199
HpyCH4V TGCA 2 cut(s) 129, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 204
KflI GGGWCCC 1 cut(s) 145
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 3 cut(s) 30, 241, 253
LpnPI CCDG 9 cut(s) 57, 74, 101, 125, 126, 135, 162, 168, 218
LweI GCATC 1 cut(s) 167
MaeI CTAG 1 cut(s) 218
MalI GATC 3 cut(s) 32, 243, 255
MboI GATC 3 cut(s) 30, 241, 253
MboII GAAGA 2 cut(s) 16, 168
MflI RGATCY 1 cut(s) 241
MluCI AATT 2 cut(s) 135, 236
MlyI GAGTC 1 cut(s) 252
MseI TTAA 2 cut(s) 183, 227
MspCI CTTAAG 1 cut(s) 182
MspI CCGG 1 cut(s) 44
MspR9I CCNGG 2 cut(s) 89, 150
MvaI CCWGG 2 cut(s) 89, 150
MwoI GCNNNNNNNGC 1 cut(s) 126
NdeII GATC 3 cut(s) 30, 241, 253
NlaIV GGNNCC 2 cut(s) 146, 147
PfeI GAWTC 3 cut(s) 7, 38, 200
PkrI GCNGC 1 cut(s) 94
PleI GAGTC 1 cut(s) 252
PpsI GAGTC 1 cut(s) 252
PpuMI RGGWCCY 2 cut(s) 145, 152
Psp5II RGGWCCY 2 cut(s) 145, 152
Psp6I CCWGG 2 cut(s) 87, 148
PspGI CCWGG 2 cut(s) 87, 148
PspN4I GGNNCC 2 cut(s) 146, 147
PspPI GGNCC 2 cut(s) 145, 152
PspPPI RGGWCCY 2 cut(s) 145, 152
PstNI CAGNNNCTG 1 cut(s) 155
PsuI RGATCY 1 cut(s) 241
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
SaqAI TTAA 2 cut(s) 183, 227
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 3 cut(s) 30, 241, 253
Sau96I GGNCC 2 cut(s) 145, 152
SchI GAGTC 1 cut(s) 252
ScrFI CCNGG 2 cut(s) 89, 150
SetI ASST 3 cut(s) 77, 90, 154
SfaNI GCATC 1 cut(s) 167
SfcI CTRYAG 1 cut(s) 114
SinI GGWCC 2 cut(s) 145, 152
SmlI CTYRAG 1 cut(s) 182
SmoI CTYRAG 1 cut(s) 182
Sse9I AATT 2 cut(s) 135, 236
SsiI CCGC 1 cut(s) 92
SspMI CTAG 1 cut(s) 218
StyD4I CCNGG 2 cut(s) 87, 148
StyI CCWWGG 1 cut(s) 57
TaqI TCGA 1 cut(s) 256
TasI AATT 2 cut(s) 135, 236
TauI GCSGC 1 cut(s) 95
TfiI GAWTC 3 cut(s) 7, 38, 200
Tru1I TTAA 2 cut(s) 183, 227
Tru9I TTAA 2 cut(s) 183, 227
TscAI CASTG 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 40
Vha464I CTTAAG 1 cut(s) 182
VpaK11BI GGWCC 2 cut(s) 145, 152
XapI RAATTY 1 cut(s) 135
XcmI CCANNNNNNNNNTGG 1 cut(s) 55
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.