FvH4_1g23570

plastid-lipid-associated protein 7

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
15413565 .. 15416023
2459 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g23570.t8

Sequence Viewer

Length: 795 bp
ATGCTTGTCCAACCACCAATCCCAACTTTCCATACTAACATTCTTCCATTGCTCAGAACCACAAACATGGTGATAACTCACACTTCACCCTCAACCACTCACCAAAAGACACAAAGCTCAAGACTTGGCGAGTGCCCACCTGGGTTCAGACCCATTCACAGAGTCAGAGTCAGAGTTGCAGAGCAAACCTCTGGCCTTGTTGGGGATGAGACACCCACCCAGATTAAAACTGAGCTTTACCAGGCACTCCAAGGTATTAATAGAGGGATATTTGGAGTCCCATCTGCAAAGAAATCTGAGATTGAAGGTTTGGTTGAGCAGTTGGAGTCTCAGAATCCAACTCCAGATCCTACTGTGAACTTAGAAAAGGTGGGTGGATGCTGGAAACTTGTGTATAGCACAATTACAATTTTAGGCTCAAGAAGAACAAAGCTAGGATTGAGGGACTTCATCTCATTGGGAGATTTCTACCAAAATATTGATGTTGCTAAGGGCAAAGCAGTCAATGTGATCGAGTTCAATGTGAGAGGATTGAATCTGTTTAATGGACGGTTAACAATTGTGGCTTCCTTCAAGAAAGCATCCAAATCAAGAGTTGACATCAGCTATGACAACTCTACAATCACTCCAGTTCAGTTGATGAACGTGTTTCGGAAAAATTATGATATTCTGCTTGGAATTTTCAATCCAGACGGTTGGCTCGAGATCACATATGTTGATGATACCGTGAGGATAGGAAGGGATGACAAAGGCAATATCTTCATATTAGAGAGATCAGAAGAAATTATGATTTGA

Protein Analysis

265

Amino Acids

29.56

Weight (kDa)

9.03

Isoelectric Point (pI)

45.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAP_fibrillin PF04755 74 - 218 3.2e-24 PAP_fibrillin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 341
AcsI RAATTY 1 cut(s) 678
AfiI CCNNNNNNNGG 1 cut(s) 202
AflIII ACRYGT 1 cut(s) 645
AgsI TTSAA 5 cut(s) 305, 520, 535, 574, 685
AjnI CCWGG 2 cut(s) 139, 240
AluBI AGCT 4 cut(s) 117, 235, 433, 606
AluI AGCT 4 cut(s) 117, 235, 433, 606
Alw26I GTCTC 2 cut(s) 203, 333
AlwI GGATC 1 cut(s) 341
Ama87I CYCGRG 1 cut(s) 701
AoxI GGCC 1 cut(s) 193
ApoI RAATTY 1 cut(s) 678
AseI ATTAAT 1 cut(s) 258
AsuHPI GGTGA 3 cut(s) 78, 82, 92
AvaI CYCGRG 1 cut(s) 701
BaeGI GKGCMC 1 cut(s) 137
BccI CCATC 1 cut(s) 289
BciT130I CCWGG 2 cut(s) 141, 242
BcoDI GTCTC 2 cut(s) 203, 333
BfaI CTAG 1 cut(s) 434
Bme1390I CCNGG 2 cut(s) 141, 242
BmeT110I CYCGRG 1 cut(s) 701
BmrFI CCNGG 2 cut(s) 141, 242
BmsI GCATC 2 cut(s) 368, 590
BplI GAGNNNNNCTC 2 cut(s) 173, 205
BpmI CTGGAG 2 cut(s) 327, 612
Bpu10I CCTNAGC 1 cut(s) 489
BpuEI CTTGAG 2 cut(s) 103, 403
BsaJI CCNNGG 2 cut(s) 140, 250
BsaXI ACNNNNNCTCC 2 cut(s) 610, 640
Bsc4I CCNNNNNNNGG 1 cut(s) 202
Bse1I ACTGG 1 cut(s) 629
Bse3DI GCAATG 1 cut(s) 47
BseBI CCWGG 2 cut(s) 141, 242
BseDI CCNNGG 2 cut(s) 140, 250
BseGI GGATG 4 cut(s) 211, 383, 581, 748
BseLI CCNNNNNNNGG 1 cut(s) 202
BseMI GCAATG 1 cut(s) 47
BseMII CTCAG 4 cut(s) 67, 222, 288, 344
BseNI ACTGG 1 cut(s) 629
BseSI GKGCMC 1 cut(s) 137
BshFI GGCC 1 cut(s) 195
BsiHKCI CYCGRG 1 cut(s) 701
BslFI GGGAC 2 cut(s) 263, 458
BslI CCNNNNNNNGG 1 cut(s) 202
BsmAI GTCTC 2 cut(s) 203, 333
BsmFI GGGAC 2 cut(s) 263, 458
BsnI GGCC 1 cut(s) 195
BsoBI CYCGRG 1 cut(s) 701
Bsp1286I GDGCHC 1 cut(s) 137
Bsp143I GATC 4 cut(s) 346, 510, 705, 773
BspANI GGCC 1 cut(s) 195
BspCNI CTCAG 4 cut(s) 66, 223, 289, 343
BspPI GGATC 1 cut(s) 341
BsrDI GCAATG 1 cut(s) 47
BsrI ACTGG 1 cut(s) 629
BssECI CCNNGG 2 cut(s) 140, 250
BssMI GATC 4 cut(s) 346, 510, 705, 773
BssT1I CCWWGG 1 cut(s) 250
Bst2UI CCWGG 2 cut(s) 141, 242
Bst4CI ACNGT 4 cut(s) 355, 552, 695, 727
BstDEI CTNAG 6 cut(s) 53, 231, 297, 330, 361, 489
BstF5I GGATG 4 cut(s) 211, 383, 581, 748
BstKTI GATC 4 cut(s) 349, 513, 708, 776
BstMAI GTCTC 2 cut(s) 203, 333
BstMBI GATC 4 cut(s) 346, 510, 705, 773
BstNI CCWGG 2 cut(s) 141, 242
BstSCI CCNGG 2 cut(s) 139, 240
BstSLI GKGCMC 1 cut(s) 137
BstX2I RGATCY 1 cut(s) 346
BstXI CCANNNNNNTGG 2 cut(s) 67, 696
BstYI RGATCY 1 cut(s) 346
BsuRI GGCC 1 cut(s) 195
BtsCI GGATG 4 cut(s) 211, 383, 581, 748
CviAII CATG 1 cut(s) 67
CviJI RGCY 8 cut(s) 117, 195, 235, 417, 433, 566, 606, 700
CviKI_1 RGCY 8 cut(s) 117, 195, 235, 417, 433, 566, 606, 700
DdeI CTNAG 6 cut(s) 53, 231, 297, 330, 361, 489
DpnI GATC 4 cut(s) 348, 512, 707, 775
DpnII GATC 4 cut(s) 346, 510, 705, 773
Eco130I CCWWGG 1 cut(s) 250
Eco88I CYCGRG 1 cut(s) 701
EcoRII CCWGG 2 cut(s) 139, 240
EcoT14I CCWWGG 1 cut(s) 250
ErhI CCWWGG 1 cut(s) 250
FaeI CATG 1 cut(s) 70
FaiI YATR 9 cut(s) 33, 68, 396, 609, 663, 712, 714, 764, 788
FaqI GGGAC 2 cut(s) 263, 458
FatI CATG 1 cut(s) 66
FauNDI CATATG 1 cut(s) 712
FokI GGATG 4 cut(s) 218, 390, 568, 755
FspBI CTAG 1 cut(s) 434
GsuI CTGGAG 2 cut(s) 327, 612
HaeIII GGCC 1 cut(s) 195
Hin1II CATG 1 cut(s) 70
HincII GTYRAC 2 cut(s) 555, 598
HindII GTYRAC 2 cut(s) 555, 598
HinfI GANTC 6 cut(s) 162, 168, 276, 326, 334, 535
HpaI GTTAAC 1 cut(s) 555
HphI GGTGA 3 cut(s) 78, 82, 92
Hpy166II GTNNAC 3 cut(s) 358, 555, 598
Hpy188I TCNGA 8 cut(s) 56, 149, 167, 173, 298, 333, 654, 778
Hpy188III TCNNGA 7 cut(s) 120, 344, 420, 574, 591, 689, 703
Hpy8I GTNNAC 3 cut(s) 358, 555, 598
HpyAV CCTTC 3 cut(s) 299, 580, 732
HpyCH4III ACNGT 4 cut(s) 355, 552, 695, 727
HpyCH4IV ACGT 1 cut(s) 645
HpyCH4V TGCA 2 cut(s) 179, 287
HpyF3I CTNAG 6 cut(s) 53, 231, 297, 330, 361, 489
HpySE526I ACGT 1 cut(s) 645
Hsp92II CATG 1 cut(s) 70
KspAI GTTAAC 1 cut(s) 555
Kzo9I GATC 4 cut(s) 346, 510, 705, 773
LweI GCATC 2 cut(s) 368, 590
MaeI CTAG 1 cut(s) 434
MaeII ACGT 1 cut(s) 645
MalI GATC 4 cut(s) 348, 512, 707, 775
MboI GATC 4 cut(s) 346, 510, 705, 773
MboII GAAGA 4 cut(s) 35, 435, 751, 791
MfeI CAATTG 1 cut(s) 558
MflI RGATCY 1 cut(s) 346
MhlI GDGCHC 1 cut(s) 137
MluCI AATT 6 cut(s) 402, 408, 558, 658, 678, 783
MlyI GAGTC 4 cut(s) 171, 177, 285, 335
MmeI TCCRAC 3 cut(s) 34, 303, 362
MnlI CCTC 6 cut(s) 100, 199, 257, 435, 521, 723
MseI TTAA 4 cut(s) 225, 258, 543, 554
MslI CAYNNNNRTG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 141, 242
MunI CAATTG 1 cut(s) 558
MvaI CCWGG 2 cut(s) 141, 242
NdeI CATATG 1 cut(s) 712
NdeII GATC 4 cut(s) 346, 510, 705, 773
NlaIII CATG 1 cut(s) 70
PaeR7I CTCGAG 1 cut(s) 701
PcsI WCGNNNNNNNCGW 1 cut(s) 699
PfeI GAWTC 2 cut(s) 334, 535
PleI GAGTC 4 cut(s) 170, 176, 284, 334
PpsI GAGTC 4 cut(s) 170, 176, 284, 334
PshBI ATTAAT 1 cut(s) 258
Psp6I CCWGG 2 cut(s) 139, 240
PspGI CCWGG 2 cut(s) 139, 240
PsuI RGATCY 1 cut(s) 346
RseI CAYNNNNRTG 1 cut(s) 65
SaqAI TTAA 4 cut(s) 225, 258, 543, 554
Sau3AI GATC 4 cut(s) 346, 510, 705, 773
SchI GAGTC 4 cut(s) 171, 177, 285, 335
ScrFI CCNGG 2 cut(s) 141, 242
SduI GDGCHC 1 cut(s) 137
SfaNI GCATC 2 cut(s) 368, 590
Sfr274I CTCGAG 1 cut(s) 701
SlaI CTCGAG 1 cut(s) 701
SmiMI CAYNNNNRTG 1 cut(s) 65
SmlI CTYRAG 3 cut(s) 118, 418, 701
SmoI CTYRAG 3 cut(s) 118, 418, 701
Sse9I AATT 6 cut(s) 402, 408, 558, 658, 678, 783
SspI AATATT 1 cut(s) 478
SspMI CTAG 1 cut(s) 434
StyD4I CCNGG 2 cut(s) 139, 240
StyI CCWWGG 1 cut(s) 250
TaaI ACNGT 4 cut(s) 355, 552, 695, 727
TaiI ACGT 1 cut(s) 648
TaqI TCGA 2 cut(s) 513, 702
TasI AATT 6 cut(s) 402, 408, 558, 658, 678, 783
TfiI GAWTC 2 cut(s) 334, 535
Tru1I TTAA 4 cut(s) 225, 258, 543, 554
Tru9I TTAA 4 cut(s) 225, 258, 543, 554
TspDTI ATGAA 3 cut(s) 439, 656, 751
VspI ATTAAT 1 cut(s) 258
XapI RAATTY 1 cut(s) 678
XhoI CTCGAG 1 cut(s) 701
XspI CTAG 1 cut(s) 434
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.