Rh2AG278400

plastid-lipid-associated protein 7

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0005160
Physical Location & Seq
Reverse (-)
33432281 .. 33433973
1693 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG278400.1

Sequence Viewer

Length: 798 bp
ATGGCCACTATGCTTGTCCAACCACCAATCCCGGCTTTTCATGCTAACATTCCTCCAATGCTCAGAACCACAAACATGGTGATAACTCCCACTTCACCCTCAACCACTCATCAAAAGACTCAAAGCTCAAGATTTGCTGAGTGCCCACCTGGGTTTAGGCCCATTTACAGAGTCAAAGTTGCAGAACAAACCTCTGGCCTAGTTGGGGATGAGACACCCACCCAGATTAAAACTGAGCTTCACCAGGCACTCCAAGGTATTAATAGAGGGATATTTGGAGTCCCATCTGCAAAGAAATCTGAGATTGAAGGTCTGGTTAAGCAGCTGGAGTCTAAGAATCCAACTCCAGATCCTACTGTGAATTTAGAAAAGGTGGGTGGCTGCTGGAAACTTGTGTATAGCACAATAACAATTTTAGGCTCAAGAAGAACAAAGCTAGGATTGAGGGACTTCATCTCATTGGGAGATTTCTACCAGAATATTGATATAGCTAAGGGCAAAGCAGTCAATGTGATCAAGTTCGATGTGAGAGGATTGAATCTCTTTAATGGACGGCTAACAATTGTGGCCTCCTTCAAAAAAGCATCCAAATCAAGAGTTGACATCAGCTATGAAAACTCTACAATCACTCCAGTTCAGTTGATGAACGTGTTTCGGAAGAATTATGATATTCTGCTTGGAATCTTCAATCCAGACGGTTGGCTCGAGATCACATACGTTGATGATACCTTGAGGATAGGAAGGGATGACAAAGGCAATATCTTCATATTAGAGAGAGCAGAAGAAAATTTGATTTAA

Protein Analysis

265

Amino Acids

29.53

Weight (kDa)

9.37

Isoelectric Point (pI)

38.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAP_fibrillin PF04755 75 - 257 3.8e-34 PAP_fibrillin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 344
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 361, 787
AfiI CCNNNNNNNGG 1 cut(s) 205
AflIII ACRYGT 1 cut(s) 648
AgsI TTSAA 4 cut(s) 308, 538, 577, 688
AjnI CCWGG 2 cut(s) 148, 243
AluBI AGCT 6 cut(s) 126, 238, 325, 436, 491, 609
AluI AGCT 6 cut(s) 126, 238, 325, 436, 491, 609
Alw26I GTCTC 1 cut(s) 206
AlwI GGATC 1 cut(s) 344
Ama87I CYCGRG 1 cut(s) 704
AoxI GGCC 4 cut(s) 3, 158, 196, 567
ApeKI GCWGC 2 cut(s) 322, 381
ApoI RAATTY 2 cut(s) 361, 787
AseI ATTAAT 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 159
AsuC2I CCSGG 1 cut(s) 32
AsuHPI GGTGA 3 cut(s) 87, 91, 233
AvaI CYCGRG 1 cut(s) 704
BaeGI GKGCMC 1 cut(s) 146
BalI TGGCCA 1 cut(s) 5
BbvI GCAGC 2 cut(s) 334, 368
BccI CCATC 1 cut(s) 292
BceAI ACGGC 1 cut(s) 569
BciT130I CCWGG 2 cut(s) 150, 245
BclI TGATCA 1 cut(s) 513
BcnI CCSGG 1 cut(s) 32
BcoDI GTCTC 1 cut(s) 206
BfaI CTAG 2 cut(s) 200, 437
BisI GCNGC 2 cut(s) 323, 382
BlsI GCNGC 2 cut(s) 324, 383
Bme1390I CCNGG 3 cut(s) 32, 150, 245
BmeT110I CYCGRG 1 cut(s) 704
BmgT120I GGNCC 1 cut(s) 159
BmrFI CCNGG 3 cut(s) 32, 150, 245
BmsI GCATC 1 cut(s) 593
BpmI CTGGAG 3 cut(s) 330, 347, 615
Bpu10I CCTNAGC 1 cut(s) 492
BpuEI CTTGAG 3 cut(s) 112, 406, 751
BpuMI CCSGG 1 cut(s) 32
BsaJI CCNNGG 2 cut(s) 149, 253
BsaXI ACNNNNNCTCC 2 cut(s) 613, 643
Bsc4I CCNNNNNNNGG 1 cut(s) 205
Bse1I ACTGG 1 cut(s) 632
BseBI CCWGG 2 cut(s) 150, 245
BseDI CCNNGG 2 cut(s) 149, 253
BseGI GGATG 3 cut(s) 214, 584, 751
BseLI CCNNNNNNNGG 1 cut(s) 205
BseMII CTCAG 4 cut(s) 76, 129, 225, 291
BseNI ACTGG 1 cut(s) 632
BseSI GKGCMC 1 cut(s) 146
BseXI GCAGC 2 cut(s) 334, 368
BshFI GGCC 4 cut(s) 5, 160, 198, 569
BsiHKCI CYCGRG 1 cut(s) 704
BsiSI CCGG 1 cut(s) 32
BslFI GGGAC 2 cut(s) 266, 461
BslI CCNNNNNNNGG 1 cut(s) 205
BsmAI GTCTC 1 cut(s) 206
BsmFI GGGAC 2 cut(s) 266, 461
BsnI GGCC 4 cut(s) 5, 160, 198, 569
BsoBI CYCGRG 1 cut(s) 704
Bsp1286I GDGCHC 1 cut(s) 146
Bsp143I GATC 3 cut(s) 349, 513, 708
BspANI GGCC 4 cut(s) 5, 160, 198, 569
BspCNI CTCAG 4 cut(s) 75, 130, 226, 292
BspPI GGATC 1 cut(s) 344
BsrI ACTGG 1 cut(s) 632
BssECI CCNNGG 2 cut(s) 149, 253
BssMI GATC 3 cut(s) 349, 513, 708
BssT1I CCWWGG 1 cut(s) 253
Bst2UI CCWGG 2 cut(s) 150, 245
Bst4CI ACNGT 2 cut(s) 358, 698
BstDEI CTNAG 6 cut(s) 62, 138, 234, 300, 333, 492
BstF5I GGATG 3 cut(s) 214, 584, 751
BstKTI GATC 3 cut(s) 352, 516, 711
BstMAI GTCTC 1 cut(s) 206
BstMBI GATC 3 cut(s) 349, 513, 708
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstNI CCWGG 2 cut(s) 150, 245
BstSCI CCNGG 3 cut(s) 30, 148, 243
BstSLI GKGCMC 1 cut(s) 146
BstV1I GCAGC 2 cut(s) 334, 368
BstX2I RGATCY 1 cut(s) 349
BstXI CCANNNNNNTGG 2 cut(s) 76, 699
BstYI RGATCY 1 cut(s) 349
BsuRI GGCC 4 cut(s) 5, 160, 198, 569
BtsCI GGATG 3 cut(s) 214, 584, 751
Cfr13I GGNCC 1 cut(s) 159
CspCI CAANNNNNGTGG 1 cut(s) 30
CviAII CATG 2 cut(s) 41, 76
DdeI CTNAG 6 cut(s) 62, 138, 234, 300, 333, 492
DpnI GATC 3 cut(s) 351, 515, 710
DpnII GATC 3 cut(s) 349, 513, 708
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 253
Eco88I CYCGRG 1 cut(s) 704
EcoRII CCWGG 2 cut(s) 148, 243
EcoT14I CCWWGG 1 cut(s) 253
ErhI CCWWGG 1 cut(s) 253
FaeI CATG 2 cut(s) 44, 79
FaiI YATR 9 cut(s) 11, 42, 77, 399, 488, 612, 666, 715, 767
FaqI GGGAC 2 cut(s) 266, 461
FatI CATG 2 cut(s) 40, 75
FbaI TGATCA 1 cut(s) 513
Fnu4HI GCNGC 2 cut(s) 323, 382
FokI GGATG 3 cut(s) 221, 571, 758
Fsp4HI GCNGC 2 cut(s) 323, 382
FspBI CTAG 2 cut(s) 200, 437
GluI GCNGC 2 cut(s) 323, 382
GsuI CTGGAG 3 cut(s) 330, 347, 615
HaeIII GGCC 4 cut(s) 5, 160, 198, 569
HapII CCGG 1 cut(s) 32
Hin1II CATG 2 cut(s) 44, 79
HincII GTYRAC 1 cut(s) 601
HindII GTYRAC 1 cut(s) 601
HinfI GANTC 7 cut(s) 118, 171, 279, 329, 337, 538, 681
HpaII CCGG 1 cut(s) 32
HphI GGTGA 3 cut(s) 87, 91, 233
Hpy166II GTNNAC 1 cut(s) 601
Hpy188I TCNGA 3 cut(s) 65, 301, 657
Hpy188III TCNNGA 6 cut(s) 129, 347, 423, 594, 692, 706
Hpy8I GTNNAC 1 cut(s) 601
HpyAV CCTTC 3 cut(s) 302, 583, 735
HpyCH4III ACNGT 2 cut(s) 358, 698
HpyCH4IV ACGT 2 cut(s) 648, 717
HpyCH4V TGCA 2 cut(s) 182, 290
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
HpyF3I CTNAG 6 cut(s) 62, 138, 234, 300, 333, 492
HpySE526I ACGT 2 cut(s) 648, 717
Hsp92II CATG 2 cut(s) 44, 79
Ksp22I TGATCA 1 cut(s) 513
Kzo9I GATC 3 cut(s) 349, 513, 708
Lsp1109I GCAGC 2 cut(s) 334, 368
LweI GCATC 1 cut(s) 593
MaeI CTAG 2 cut(s) 200, 437
MaeII ACGT 2 cut(s) 648, 717
MalI GATC 3 cut(s) 351, 515, 710
MboI GATC 3 cut(s) 349, 513, 708
MboII GAAGA 5 cut(s) 438, 670, 676, 754, 794
MfeI CAATTG 1 cut(s) 561
MflI RGATCY 1 cut(s) 349
MhlI GDGCHC 1 cut(s) 146
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 5 cut(s) 361, 411, 561, 661, 787
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 4 cut(s) 112, 180, 288, 338
MmeI TCCRAC 2 cut(s) 43, 365
MnlI CCTC 8 cut(s) 63, 109, 202, 260, 438, 524, 580, 726
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 5 cut(s) 228, 261, 318, 546, 796
MslI CAYNNNNRTG 1 cut(s) 74
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 1 cut(s) 325
MspI CCGG 1 cut(s) 32
MspR9I CCNGG 3 cut(s) 32, 150, 245
MunI CAATTG 1 cut(s) 561
MvaI CCWGG 2 cut(s) 150, 245
MwoI GCNNNNNNNGC 1 cut(s) 41
NciI CCSGG 1 cut(s) 32
NdeII GATC 3 cut(s) 349, 513, 708
NlaIII CATG 2 cut(s) 44, 79
PaeR7I CTCGAG 1 cut(s) 704
PcsI WCGNNNNNNNCGW 1 cut(s) 702
PfeI GAWTC 3 cut(s) 337, 538, 681
PkrI GCNGC 2 cut(s) 324, 383
PleI GAGTC 4 cut(s) 112, 179, 287, 337
PpsI GAGTC 4 cut(s) 112, 179, 287, 337
PshBI ATTAAT 1 cut(s) 261
Psp6I CCWGG 2 cut(s) 148, 243
PspGI CCWGG 2 cut(s) 148, 243
PspPI GGNCC 1 cut(s) 159
PsuI RGATCY 1 cut(s) 349
PvuII CAGCTG 1 cut(s) 325
RseI CAYNNNNRTG 1 cut(s) 74
SaqAI TTAA 5 cut(s) 228, 261, 318, 546, 796
SatI GCNGC 2 cut(s) 323, 382
Sau3AI GATC 3 cut(s) 349, 513, 708
Sau96I GGNCC 1 cut(s) 159
SchI GAGTC 4 cut(s) 112, 180, 288, 338
ScrFI CCNGG 3 cut(s) 32, 150, 245
SduI GDGCHC 1 cut(s) 146
SfaNI GCATC 1 cut(s) 593
Sfr274I CTCGAG 1 cut(s) 704
SlaI CTCGAG 1 cut(s) 704
SmiMI CAYNNNNRTG 1 cut(s) 74
SmlI CTYRAG 4 cut(s) 127, 421, 704, 730
SmoI CTYRAG 4 cut(s) 127, 421, 704, 730
Sse9I AATT 5 cut(s) 361, 411, 561, 661, 787
SspI AATATT 1 cut(s) 481
SspMI CTAG 2 cut(s) 200, 437
StyD4I CCNGG 3 cut(s) 30, 148, 243
StyI CCWWGG 1 cut(s) 253
TaaI ACNGT 2 cut(s) 358, 698
TaiI ACGT 2 cut(s) 651, 720
TaqI TCGA 2 cut(s) 522, 705
TasI AATT 5 cut(s) 361, 411, 561, 661, 787
TfiI GAWTC 3 cut(s) 337, 538, 681
Tru1I TTAA 5 cut(s) 228, 261, 318, 546, 796
Tru9I TTAA 5 cut(s) 228, 261, 318, 546, 796
TseI GCWGC 2 cut(s) 322, 381
TspDTI ATGAA 5 cut(s) 29, 442, 627, 659, 754
VspI ATTAAT 1 cut(s) 261
XapI RAATTY 2 cut(s) 361, 787
XhoI CTCGAG 1 cut(s) 704
XspI CTAG 2 cut(s) 200, 437
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.