Rmu_sc0001653.1_g000011

plastid-lipid-associated protein 7

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001653.1
Physical Location & Seq
Forward (+)
48125 .. 49796
1672 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001653.1_g000011.1.cds

Sequence Viewer

Length: 789 bp
atgcttgtccaaccaccaatcccggctttccatgctaacattcctccaatgctcagaaccacaaacatggtgataactcccacttcaccctcaaccactcatcaaaagactcaaagcttaagatttggtgactacccacctgggtttaggcccatttacagagtcaaagttgcagaacaaacctctggcctagttggggatgagacacccacccagattaaaactgagcttcaccaggcactccaaggtattaatagagggatatttggagtcccatctgcaaagaaatctgagattgaaggtctggttaagcagctggagtcaaagaatccaactccagatcctactgtgaatttagaaaaggtgggtggctgctggaaacttgtgtatagcacaataacaattttaggctcaagaagaacaaagctaggattgagggacttcatctcattgggagatttctaccagaatattgatattgctaagggcaaagcagtcaatgtgatcaagttcgatgtgagaggattggatctctttaatggacggctaacaattgtggcctccttcaagaaagcatccaaatcaagagttgacatcagctatgaaaactctacaatcactccagttcagttgatgaacgtgtttcggaaaaattatgatattctgcttggaatcttcaatccagatggttggctcgagatcacatacgttgatgataccttgaggataggaagggatgacaaaggcaatatcttcatattagagagagcagaagaaaattttatttaa

Protein Analysis

262

Amino Acids

29.32

Weight (kDa)

9.32

Isoelectric Point (pI)

35.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 335, 537
AcsI RAATTY 2 cut(s) 352, 778
AfiI CCNNNNNNNGG 1 cut(s) 196
AflII CTTAAG 1 cut(s) 118
AflIII ACRYGT 1 cut(s) 639
AgsI TTSAA 3 cut(s) 299, 568, 679
AjnI CCWGG 2 cut(s) 139, 234
AluBI AGCT 5 cut(s) 117, 229, 316, 427, 600
AluI AGCT 5 cut(s) 117, 229, 316, 427, 600
Alw26I GTCTC 1 cut(s) 197
AlwI GGATC 2 cut(s) 335, 537
Ama87I CYCGRG 1 cut(s) 695
AoxI GGCC 3 cut(s) 149, 187, 558
ApeKI GCWGC 2 cut(s) 313, 372
ApoI RAATTY 2 cut(s) 352, 778
AseI ATTAAT 1 cut(s) 252
AspS9I GGNCC 1 cut(s) 150
AsuC2I CCSGG 1 cut(s) 23
AsuHPI GGTGA 4 cut(s) 78, 82, 140, 224
AvaI CYCGRG 1 cut(s) 695
BbvI GCAGC 2 cut(s) 325, 359
BccI CCATC 2 cut(s) 283, 680
BceAI ACGGC 1 cut(s) 560
BciT130I CCWGG 2 cut(s) 141, 236
BclI TGATCA 1 cut(s) 504
BcnI CCSGG 1 cut(s) 23
BcoDI GTCTC 1 cut(s) 197
BfaI CTAG 2 cut(s) 191, 428
BfrI CTTAAG 1 cut(s) 118
BisI GCNGC 2 cut(s) 314, 373
BlsI GCNGC 2 cut(s) 315, 374
Bme1390I CCNGG 3 cut(s) 23, 141, 236
BmeT110I CYCGRG 1 cut(s) 695
BmgT120I GGNCC 1 cut(s) 150
BmrFI CCNGG 3 cut(s) 23, 141, 236
BmsI GCATC 1 cut(s) 584
BpmI CTGGAG 3 cut(s) 321, 338, 606
Bpu10I CCTNAGC 1 cut(s) 483
BpuEI CTTGAG 2 cut(s) 397, 742
BpuMI CCSGG 1 cut(s) 23
BsaJI CCNNGG 2 cut(s) 140, 244
BsaXI ACNNNNNCTCC 2 cut(s) 604, 634
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse1I ACTGG 1 cut(s) 623
BseBI CCWGG 2 cut(s) 141, 236
BseDI CCNNGG 2 cut(s) 140, 244
BseGI GGATG 3 cut(s) 205, 575, 742
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMII CTCAG 3 cut(s) 67, 216, 282
BseNI ACTGG 1 cut(s) 623
BseXI GCAGC 2 cut(s) 325, 359
BshFI GGCC 3 cut(s) 151, 189, 560
BsiHKCI CYCGRG 1 cut(s) 695
BsiSI CCGG 1 cut(s) 23
BslFI GGGAC 2 cut(s) 257, 452
BslI CCNNNNNNNGG 1 cut(s) 196
BsmAI GTCTC 1 cut(s) 197
BsmFI GGGAC 2 cut(s) 257, 452
BsnI GGCC 3 cut(s) 151, 189, 560
BsoBI CYCGRG 1 cut(s) 695
Bsp143I GATC 4 cut(s) 340, 504, 529, 699
BspANI GGCC 3 cut(s) 151, 189, 560
BspCNI CTCAG 3 cut(s) 66, 217, 283
BspPI GGATC 2 cut(s) 335, 537
BspTI CTTAAG 1 cut(s) 118
BsrI ACTGG 1 cut(s) 623
BssECI CCNNGG 2 cut(s) 140, 244
BssMI GATC 4 cut(s) 340, 504, 529, 699
BssT1I CCWWGG 1 cut(s) 244
Bst2UI CCWGG 2 cut(s) 141, 236
Bst4CI ACNGT 1 cut(s) 349
BstAFI CTTAAG 1 cut(s) 118
BstDEI CTNAG 4 cut(s) 53, 225, 291, 483
BstF5I GGATG 3 cut(s) 205, 575, 742
BstKTI GATC 4 cut(s) 343, 507, 532, 702
BstMAI GTCTC 1 cut(s) 197
BstMBI GATC 4 cut(s) 340, 504, 529, 699
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstNI CCWGG 2 cut(s) 141, 236
BstSCI CCNGG 3 cut(s) 21, 139, 234
BstV1I GCAGC 2 cut(s) 325, 359
BstX2I RGATCY 2 cut(s) 340, 529
BstXI CCANNNNNNTGG 2 cut(s) 67, 690
BstYI RGATCY 2 cut(s) 340, 529
BsuRI GGCC 3 cut(s) 151, 189, 560
BtsCI GGATG 3 cut(s) 205, 575, 742
Cfr13I GGNCC 1 cut(s) 150
CviAII CATG 2 cut(s) 32, 67
DdeI CTNAG 4 cut(s) 53, 225, 291, 483
DpnI GATC 4 cut(s) 342, 506, 531, 701
DpnII GATC 4 cut(s) 340, 504, 529, 699
Eco130I CCWWGG 1 cut(s) 244
Eco88I CYCGRG 1 cut(s) 695
EcoRII CCWGG 2 cut(s) 139, 234
EcoT14I CCWWGG 1 cut(s) 244
ErhI CCWWGG 1 cut(s) 244
FaeI CATG 2 cut(s) 35, 70
FaiI YATR 7 cut(s) 33, 68, 390, 603, 657, 706, 758
FaqI GGGAC 2 cut(s) 257, 452
FatI CATG 2 cut(s) 31, 66
FbaI TGATCA 1 cut(s) 504
Fnu4HI GCNGC 2 cut(s) 314, 373
FokI GGATG 3 cut(s) 212, 562, 749
Fsp4HI GCNGC 2 cut(s) 314, 373
FspBI CTAG 2 cut(s) 191, 428
GluI GCNGC 2 cut(s) 314, 373
GsuI CTGGAG 3 cut(s) 321, 338, 606
HaeIII GGCC 3 cut(s) 151, 189, 560
HapII CCGG 1 cut(s) 23
Hin1II CATG 2 cut(s) 35, 70
HincII GTYRAC 1 cut(s) 592
HindII GTYRAC 1 cut(s) 592
HindIII AAGCTT 1 cut(s) 115
HinfI GANTC 6 cut(s) 109, 162, 270, 320, 328, 672
HpaII CCGG 1 cut(s) 23
HphI GGTGA 4 cut(s) 78, 82, 140, 224
Hpy166II GTNNAC 1 cut(s) 592
Hpy188I TCNGA 3 cut(s) 56, 292, 648
Hpy188III TCNNGA 6 cut(s) 338, 414, 568, 585, 683, 697
Hpy8I GTNNAC 1 cut(s) 592
HpyAV CCTTC 3 cut(s) 293, 574, 726
HpyCH4III ACNGT 1 cut(s) 349
HpyCH4IV ACGT 2 cut(s) 639, 708
HpyCH4V TGCA 2 cut(s) 173, 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpyF3I CTNAG 4 cut(s) 53, 225, 291, 483
HpySE526I ACGT 2 cut(s) 639, 708
Hsp92II CATG 2 cut(s) 35, 70
Ksp22I TGATCA 1 cut(s) 504
Kzo9I GATC 4 cut(s) 340, 504, 529, 699
Lsp1109I GCAGC 2 cut(s) 325, 359
LweI GCATC 1 cut(s) 584
MaeI CTAG 2 cut(s) 191, 428
MaeII ACGT 2 cut(s) 639, 708
MaeIII GTNAC 1 cut(s) 128
MalI GATC 4 cut(s) 342, 506, 531, 701
MboI GATC 4 cut(s) 340, 504, 529, 699
MboII GAAGA 4 cut(s) 429, 667, 745, 785
MfeI CAATTG 1 cut(s) 552
MflI RGATCY 2 cut(s) 340, 529
MluCI AATT 5 cut(s) 352, 402, 552, 652, 778
MlyI GAGTC 4 cut(s) 103, 171, 279, 329
MmeI TCCRAC 2 cut(s) 34, 356
MnlI CCTC 8 cut(s) 54, 100, 193, 251, 429, 515, 571, 717
MseI TTAA 6 cut(s) 119, 219, 252, 309, 537, 787
MslI CAYNNNNRTG 1 cut(s) 65
MspA1I CMGCKG 1 cut(s) 316
MspCI CTTAAG 1 cut(s) 118
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 3 cut(s) 23, 141, 236
MunI CAATTG 1 cut(s) 552
MvaI CCWGG 2 cut(s) 141, 236
MwoI GCNNNNNNNGC 1 cut(s) 32
NciI CCSGG 1 cut(s) 23
NdeII GATC 4 cut(s) 340, 504, 529, 699
NlaIII CATG 2 cut(s) 35, 70
NmuCI GTSAC 1 cut(s) 128
PaeR7I CTCGAG 1 cut(s) 695
PfeI GAWTC 2 cut(s) 328, 672
PkrI GCNGC 2 cut(s) 315, 374
PleI GAGTC 4 cut(s) 103, 170, 278, 328
PpsI GAGTC 4 cut(s) 103, 170, 278, 328
PshBI ATTAAT 1 cut(s) 252
Psp6I CCWGG 2 cut(s) 139, 234
PspGI CCWGG 2 cut(s) 139, 234
PspPI GGNCC 1 cut(s) 150
PsuI RGATCY 2 cut(s) 340, 529
PvuII CAGCTG 1 cut(s) 316
RseI CAYNNNNRTG 1 cut(s) 65
SaqAI TTAA 6 cut(s) 119, 219, 252, 309, 537, 787
SatI GCNGC 2 cut(s) 314, 373
Sau3AI GATC 4 cut(s) 340, 504, 529, 699
Sau96I GGNCC 1 cut(s) 150
SchI GAGTC 4 cut(s) 103, 171, 279, 329
ScrFI CCNGG 3 cut(s) 23, 141, 236
SfaNI GCATC 1 cut(s) 584
Sfr274I CTCGAG 1 cut(s) 695
SlaI CTCGAG 1 cut(s) 695
SmiMI CAYNNNNRTG 1 cut(s) 65
SmlI CTYRAG 4 cut(s) 118, 412, 695, 721
SmoI CTYRAG 4 cut(s) 118, 412, 695, 721
Sse9I AATT 5 cut(s) 352, 402, 552, 652, 778
SspI AATATT 1 cut(s) 472
SspMI CTAG 2 cut(s) 191, 428
StyD4I CCNGG 3 cut(s) 21, 139, 234
StyI CCWWGG 1 cut(s) 244
TaaI ACNGT 1 cut(s) 349
TaiI ACGT 2 cut(s) 642, 711
TaqI TCGA 2 cut(s) 513, 696
TasI AATT 5 cut(s) 352, 402, 552, 652, 778
TfiI GAWTC 2 cut(s) 328, 672
Tru1I TTAA 6 cut(s) 119, 219, 252, 309, 537, 787
Tru9I TTAA 6 cut(s) 119, 219, 252, 309, 537, 787
TseFI GTSAC 1 cut(s) 128
TseI GCWGC 2 cut(s) 313, 372
Tsp45I GTSAC 1 cut(s) 128
TspDTI ATGAA 4 cut(s) 433, 618, 650, 745
Vha464I CTTAAG 1 cut(s) 118
VspI ATTAAT 1 cut(s) 252
XapI RAATTY 2 cut(s) 352, 778
XhoI CTCGAG 1 cut(s) 695
XspI CTAG 2 cut(s) 191, 428
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.