FvH4_2g21220

H ACA ribonucleoprotein complex subunit 3-like

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Forward (+)
17645628 .. 17647521
1894 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g21220.t1

Sequence Viewer

Length: 195 bp
ATGTATCTTCAGTTCTACATCAATGAGAACGGGGACAAAGTCTACACCACTAAGAAAGAATCACCGCTGGGGCTGGCTACGCAATCTGCCCACCCTGCTCGCTTCTCCCCGGATGACAAGTATTCAAGGCAAAGATATCTTTTGAAGAAGCGCTTTGGATTGTTGCCAACCCAGCAGTCTCCTCTCAAATACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.53

Weight (kDa)

9.79

Isoelectric Point (pI)

62.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Nop10p PF04135 3 - 52 1.6e-20 Nucleolar RNA-binding protein, Nop10p family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012395)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 42
AciI CCGC 1 cut(s) 65
AfeI AGCGCT 1 cut(s) 152
AgsI TTSAA 2 cut(s) 126, 145
Alw26I GTCTC 1 cut(s) 183
Aor51HI AGCGCT 1 cut(s) 152
AspLEI GCGC 1 cut(s) 153
AsuC2I CCSGG 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 54
BcnI CCSGG 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 183
BfoI RGCGCY 1 cut(s) 154
Bme1390I CCNGG 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 110
BpuMI CCSGG 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 108
BseGI GGATG 1 cut(s) 118
BseRI GAGGAG 1 cut(s) 171
BseYI CCCAGC 2 cut(s) 67, 171
BsiSI CCGG 1 cut(s) 110
BslFI GGGAC 1 cut(s) 47
BsmAI GTCTC 1 cut(s) 183
BsmFI GGGAC 1 cut(s) 47
BspACI CCGC 1 cut(s) 65
BssECI CCNNGG 1 cut(s) 108
BstC8I GCNNGC 2 cut(s) 75, 100
BstDEI CTNAG 1 cut(s) 51
BstF5I GGATG 1 cut(s) 118
BstH2I RGCGCY 1 cut(s) 154
BstHHI GCGC 1 cut(s) 153
BstMAI GTCTC 1 cut(s) 183
BstMWI GCNNNNNNNGC 3 cut(s) 79, 95, 172
BstSCI CCNGG 1 cut(s) 108
BtsCI GGATG 1 cut(s) 118
Cac8I GCNNGC 2 cut(s) 75, 100
CfoI GCGC 1 cut(s) 153
CviJI RGCY 2 cut(s) 73, 77
CviKI_1 RGCY 2 cut(s) 73, 77
DdeI CTNAG 1 cut(s) 51
Eco32I GATATC 1 cut(s) 137
Eco47III AGCGCT 1 cut(s) 152
EcoRV GATATC 1 cut(s) 137
FalI AAGNNNNNCTT 2 cut(s) 137, 169
FaqI GGGAC 1 cut(s) 47
FblI GTMKAC 1 cut(s) 42
FokI GGATG 1 cut(s) 125
GlaI GCGC 1 cut(s) 152
GsaI CCCAGC 2 cut(s) 71, 175
HaeII RGCGCY 1 cut(s) 154
HapII CCGG 1 cut(s) 110
HhaI GCGC 1 cut(s) 153
Hin6I GCGC 1 cut(s) 151
HinP1I GCGC 1 cut(s) 151
HinfI GANTC 1 cut(s) 59
HpaII CCGG 1 cut(s) 110
HphI GGTGA 1 cut(s) 54
Hpy166II GTNNAC 1 cut(s) 43
Hpy8I GTNNAC 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 3 cut(s) 79, 95, 172
HpyF3I CTNAG 1 cut(s) 51
HspAI GCGC 1 cut(s) 151
LpnPI CCDG 5 cut(s) 53, 59, 108, 123, 185
MboII GAAGA 1 cut(s) 157
MnlI CCTC 1 cut(s) 192
MspA1I CMGCKG 1 cut(s) 67
MspI CCGG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 110
MwoI GCNNNNNNNGC 3 cut(s) 79, 95, 172
NciI CCSGG 1 cut(s) 110
PfeI GAWTC 1 cut(s) 59
PflFI GACNNNGTC 1 cut(s) 38
PspFI CCCAGC 2 cut(s) 67, 171
PsrI GAACNNNNNNTAC 1 cut(s) 28
PsyI GACNNNGTC 1 cut(s) 38
ScrFI CCNGG 1 cut(s) 110
SsiI CCGC 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 108
TfiI GAWTC 1 cut(s) 59
Tth111I GACNNNGTC 1 cut(s) 38
XmiI GTMKAC 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.