MD05G1194800.v1.1

H ACA ribonucleoprotein complex subunit 3-like protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Forward (+)
32222749 .. 32224241
1493 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1194800.v1.1.491

Sequence Viewer

Length: 195 bp
ATGTATCTTCAGTACTACATAAACGAGAACGGCAACAAAGTGTACACTACCAAGAAGGAATCACCACTTGGGGAAGCTACACAATCTGCCCATCCAGCCCGCTTCTCCCCAGATGACAAATTTTCGAGGCAAAGATATCTTCTGAAGAAGCGCTTTGGATTGTTGCCAACCCAGCAGTCACCTCTAAAGCATTGA
Functional Annotation

Protein Analysis

65

Amino Acids

7.52

Weight (kDa)

9.85

Isoelectric Point (pI)

61.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Nop10p PF04135 3 - 52 2.1e-21 Nucleolar RNA-binding protein, Nop10p family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012395)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 100
AcsI RAATTY 1 cut(s) 119
AcuI CTGAAG 1 cut(s) 164
AfaI GTAC 2 cut(s) 14, 44
AfeI AGCGCT 1 cut(s) 152
AjuI GAANNNNNNNTTGG 2 cut(s) 51, 83
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
Aor51HI AGCGCT 1 cut(s) 152
ApoI RAATTY 1 cut(s) 119
AspLEI GCGC 1 cut(s) 153
AsuHPI GGTGA 2 cut(s) 54, 171
BccI CCATC 1 cut(s) 99
BceAI ACGGC 1 cut(s) 46
BfoI RGCGCY 1 cut(s) 154
BmcAI AGTACT 1 cut(s) 14
BseGI GGATG 1 cut(s) 91
BseYI CCCAGC 1 cut(s) 171
Bsp1407I TGTACA 1 cut(s) 42
BspACI CCGC 1 cut(s) 100
BsrGI TGTACA 1 cut(s) 42
BstAUI TGTACA 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 100
BstF5I GGATG 1 cut(s) 91
BstH2I RGCGCY 1 cut(s) 154
BstHHI GCGC 1 cut(s) 153
BstMWI GCNNNNNNNGC 2 cut(s) 95, 172
BtsCI GGATG 1 cut(s) 91
Cac8I GCNNGC 1 cut(s) 100
CfoI GCGC 1 cut(s) 153
Csp6I GTAC 2 cut(s) 13, 43
CviJI RGCY 2 cut(s) 77, 98
CviKI_1 RGCY 2 cut(s) 77, 98
CviQI GTAC 2 cut(s) 13, 43
Eco32I GATATC 1 cut(s) 137
Eco47III AGCGCT 1 cut(s) 152
Eco57I CTGAAG 1 cut(s) 164
EcoRV GATATC 1 cut(s) 137
FaiI YATR 1 cut(s) 20
FalI AAGNNNNNCTT 2 cut(s) 137, 169
FauI CCCGC 1 cut(s) 107
FokI GGATG 1 cut(s) 78
GlaI GCGC 1 cut(s) 152
GsaI CCCAGC 1 cut(s) 175
HaeII RGCGCY 1 cut(s) 154
HhaI GCGC 1 cut(s) 153
Hin6I GCGC 1 cut(s) 151
HinP1I GCGC 1 cut(s) 151
HinfI GANTC 1 cut(s) 59
HphI GGTGA 2 cut(s) 54, 171
Hpy166II GTNNAC 2 cut(s) 43, 45
Hpy188I TCNGA 1 cut(s) 144
Hpy8I GTNNAC 2 cut(s) 43, 45
HpyAV CCTTC 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 172
HspAI GCGC 1 cut(s) 151
LpnPI CCDG 3 cut(s) 108, 123, 185
MaeIII GTNAC 1 cut(s) 177
MboII GAAGA 2 cut(s) 131, 157
MluCI AATT 1 cut(s) 119
MnlI CCTC 2 cut(s) 120, 192
MwoI GCNNNNNNNGC 2 cut(s) 95, 172
NmuCI GTSAC 1 cut(s) 177
PfeI GAWTC 1 cut(s) 59
PspFI CCCAGC 1 cut(s) 171
RsaI GTAC 2 cut(s) 14, 44
RsaNI GTAC 2 cut(s) 13, 43
ScaI AGTACT 1 cut(s) 14
SetI ASST 2 cut(s) 79, 184
SgeI CNNG 8 cut(s) 37, 64, 80, 107, 111, 122, 138, 184
Sse9I AATT 1 cut(s) 119
SsiI CCGC 1 cut(s) 100
TaqI TCGA 1 cut(s) 125
TasI AATT 1 cut(s) 119
TatI WGTACW 2 cut(s) 12, 42
TfiI GAWTC 1 cut(s) 59
TseFI GTSAC 1 cut(s) 177
Tsp45I GTSAC 1 cut(s) 177
XapI RAATTY 1 cut(s) 119
ZrmI AGTACT 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.