MD10G1181400.v1.1

H ACA ribonucleoprotein complex subunit 3-like protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
27441307 .. 27442810
1504 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1181400.v1.1.491

Sequence Viewer

Length: 195 bp
ATGTATCTTCAATACTACATAAACGAGAATGGCAACAAAGTGTACACCACCAAGAGGGAATCACCACTTGGGCATGCTACGCAATCTGCCCATCCCGCCCGCTTCTCCCCTGATGACAAATATTCAAGGCAAAGGTATCTTCTGAAGAAGCGCTTTGGATTGTTGCCAACCCAGCAGTCACCTCTAAAGTACTGA
Functional Annotation

Protein Analysis

65

Amino Acids

7.6

Weight (kDa)

9.93

Isoelectric Point (pI)

67.68

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Nop10p PF04135 3 - 52 4.8e-21 Nucleolar RNA-binding protein, Nop10p family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012395)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 96, 100
AcuI CTGAAG 1 cut(s) 164
AfaI GTAC 2 cut(s) 44, 191
AfeI AGCGCT 1 cut(s) 152
AfiI CCNNNNNNNGG 1 cut(s) 54
AgsI TTSAA 2 cut(s) 11, 126
AjuI GAANNNNNNNTTGG 2 cut(s) 51, 83
Aor51HI AGCGCT 1 cut(s) 152
AspLEI GCGC 1 cut(s) 153
AsuHPI GGTGA 2 cut(s) 54, 171
BccI CCATC 1 cut(s) 99
BfoI RGCGCY 1 cut(s) 154
BmcAI AGTACT 1 cut(s) 191
Bsc4I CCNNNNNNNGG 1 cut(s) 54
BseGI GGATG 1 cut(s) 91
BseLI CCNNNNNNNGG 1 cut(s) 54
BseYI CCCAGC 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 54
Bsp1407I TGTACA 1 cut(s) 42
BspACI CCGC 2 cut(s) 96, 100
BsrGI TGTACA 1 cut(s) 42
BstAUI TGTACA 1 cut(s) 42
BstC8I GCNNGC 2 cut(s) 75, 100
BstF5I GGATG 1 cut(s) 91
BstH2I RGCGCY 1 cut(s) 154
BstHHI GCGC 1 cut(s) 153
BstMWI GCNNNNNNNGC 3 cut(s) 79, 95, 172
BstNSI RCATGY 1 cut(s) 77
BtsCI GGATG 1 cut(s) 91
Cac8I GCNNGC 2 cut(s) 75, 100
CfoI GCGC 1 cut(s) 153
Csp6I GTAC 2 cut(s) 43, 190
CviAII CATG 1 cut(s) 74
CviQI GTAC 2 cut(s) 43, 190
Eco47III AGCGCT 1 cut(s) 152
Eco57I CTGAAG 1 cut(s) 164
FaeI CATG 1 cut(s) 77
FaiI YATR 2 cut(s) 20, 75
FalI AAGNNNNNCTT 2 cut(s) 137, 169
FatI CATG 1 cut(s) 73
FauI CCCGC 2 cut(s) 103, 107
FokI GGATG 1 cut(s) 78
GlaI GCGC 1 cut(s) 152
GsaI CCCAGC 1 cut(s) 175
HaeII RGCGCY 1 cut(s) 154
HhaI GCGC 1 cut(s) 153
Hin1II CATG 1 cut(s) 77
Hin6I GCGC 1 cut(s) 151
HinP1I GCGC 1 cut(s) 151
HinfI GANTC 1 cut(s) 59
HphI GGTGA 2 cut(s) 54, 171
Hpy166II GTNNAC 2 cut(s) 43, 45
Hpy188I TCNGA 1 cut(s) 144
Hpy8I GTNNAC 2 cut(s) 43, 45
HpyF10VI GCNNNNNNNGC 3 cut(s) 79, 95, 172
Hsp92II CATG 1 cut(s) 77
HspAI GCGC 1 cut(s) 151
LpnPI CCDG 2 cut(s) 123, 185
MaeIII GTNAC 1 cut(s) 177
MboII GAAGA 2 cut(s) 131, 157
MnlI CCTC 2 cut(s) 48, 192
MwoI GCNNNNNNNGC 3 cut(s) 79, 95, 172
NlaIII CATG 1 cut(s) 77
NmuCI GTSAC 1 cut(s) 177
NspI RCATGY 1 cut(s) 77
PaeI GCATGC 1 cut(s) 77
PfeI GAWTC 1 cut(s) 59
PspFI CCCAGC 1 cut(s) 171
RsaI GTAC 2 cut(s) 44, 191
RsaNI GTAC 2 cut(s) 43, 190
ScaI AGTACT 1 cut(s) 191
SetI ASST 2 cut(s) 137, 184
SgeI CNNG 9 cut(s) 37, 64, 80, 86, 107, 111, 122, 138, 184
SphI GCATGC 1 cut(s) 77
SsiI CCGC 2 cut(s) 96, 100
SspI AATATT 1 cut(s) 122
TatI WGTACW 2 cut(s) 42, 189
TfiI GAWTC 1 cut(s) 59
TseFI GTSAC 1 cut(s) 177
Tsp45I GTSAC 1 cut(s) 177
XceI RCATGY 1 cut(s) 77
ZrmI AGTACT 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.