FvH4_6g41490

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0004059
Physical Location & Seq
Reverse (-)
32594947 .. 32596933
1987 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g41490.t1

Sequence Viewer

Length: 504 bp
ATGGCGTCGTCTCTGCTCATGAAACCAACAGTCACCTGTAACAAAGATGAGGTGTATGTTGCGGCAGTGCCTCTAAGAGCCACAAAAGGACCTGCCCAGTTCATCACCTCTACTGCTTACTCTCTCAATCTATGGGATTTGCAGCACTTCATGGTCATCATTAAACCCTCCTCACCACCGCCACATTCTCAGGCTTTGGTTTTTGATTTTCAACCTAAAGATCCTGAAAACATATATGCAGCACTTGCAGTTCTATCTGGTAAATCAGTACCAGGAGTTATTCTAACGAGGAGGTTATCAAAGCTGCCAAGAACCAAATGCTGGTTTGTGGGATCTTCTAAAGCAGGTGCCATCGATATTGCTAGGGAATTTAACAAAGGCTGGGAAACTCATTTAAGGGTTGGCCATCATGACTGTCGAAACTATACCAATGGCCTAGTCGAGTACTTAACAGGTGAAAAGTATGTATTGGATCGCTTGAGAAGTACTGATACTAAGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

168

Amino Acids

18.65

Weight (kDa)

9.51

Isoelectric Point (pI)

40.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 335
Acc36I ACCTGC 2 cut(s) 100, 335
AccB1I GGYRCC 1 cut(s) 347
AccB7I CCANNNNNTGG 1 cut(s) 321
AciI CCGC 2 cut(s) 62, 179
AclWI GGATC 3 cut(s) 215, 340, 480
AcoI YGGCCR 1 cut(s) 403
AcsI RAATTY 1 cut(s) 368
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 3 cut(s) 270, 446, 487
AfiI CCNNNNNNNGG 1 cut(s) 321
AgsI TTSAA 1 cut(s) 212
AjnI CCWGG 1 cut(s) 271
AluBI AGCT 1 cut(s) 304
AluI AGCT 1 cut(s) 304
Alw26I GTCTC 1 cut(s) 15
AlwI GGATC 3 cut(s) 215, 340, 480
AoxI GGCC 2 cut(s) 403, 433
ApeKI GCWGC 3 cut(s) 142, 239, 304
ApoI RAATTY 1 cut(s) 368
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 4 cut(s) 25, 97, 165, 467
AvaII GGWCC 1 cut(s) 89
BalI TGGCCA 1 cut(s) 405
BanI GGYRCC 1 cut(s) 347
BarI GAAGNNNNNNTAC 1 cut(s) 475
BbvI GCAGC 3 cut(s) 154, 251, 291
BccI CCATC 2 cut(s) 359, 414
BciT130I CCWGG 1 cut(s) 273
BcoDI GTCTC 1 cut(s) 15
BfaI CTAG 2 cut(s) 363, 437
BfuAI ACCTGC 2 cut(s) 100, 335
BisI GCNGC 4 cut(s) 63, 143, 240, 305
BlsI GCNGC 4 cut(s) 64, 144, 241, 306
BmcAI AGTACT 2 cut(s) 446, 487
Bme1390I CCNGG 1 cut(s) 273
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 349
BmrFI CCNGG 1 cut(s) 273
BmrI ACTGGG 1 cut(s) 91
BmuI ACTGGG 1 cut(s) 91
BpuEI CTTGAG 1 cut(s) 499
Bsa29I ATCGAT 1 cut(s) 354
BsaHI GRCGYC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 1 cut(s) 321
Bse1I ACTGG 1 cut(s) 97
BseBI CCWGG 1 cut(s) 273
BseCI ATCGAT 1 cut(s) 354
BseLI CCNNNNNNNGG 1 cut(s) 321
BseMII CTCAG 1 cut(s) 203
BseNI ACTGG 1 cut(s) 97
BseRI GAGGAG 2 cut(s) 160, 304
BseXI GCAGC 3 cut(s) 154, 251, 291
BseYI CCCAGC 1 cut(s) 381
BshFI GGCC 2 cut(s) 405, 435
BshNI GGYRCC 1 cut(s) 347
BshVI ATCGAT 1 cut(s) 354
BslI CCNNNNNNNGG 1 cut(s) 321
BsmAI GTCTC 1 cut(s) 15
BsmBI CGTCTC 1 cut(s) 15
BsnI GGCC 2 cut(s) 405, 435
Bsp143I GATC 3 cut(s) 220, 332, 472
BspACI CCGC 2 cut(s) 62, 179
BspANI GGCC 2 cut(s) 405, 435
BspCNI CTCAG 1 cut(s) 202
BspDI ATCGAT 1 cut(s) 354
BspHI TCATGA 2 cut(s) 18, 409
BspLI GGNNCC 1 cut(s) 349
BspMI ACCTGC 2 cut(s) 100, 335
BspPI GGATC 3 cut(s) 215, 340, 480
BspT107I GGYRCC 1 cut(s) 347
BsrI ACTGG 1 cut(s) 97
BssMI GATC 3 cut(s) 220, 332, 472
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 273
Bst4CI ACNGT 2 cut(s) 31, 416
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 245
BstDEI CTNAG 3 cut(s) 74, 189, 495
BstKTI GATC 3 cut(s) 223, 335, 475
BstMAI GTCTC 1 cut(s) 15
BstMBI GATC 3 cut(s) 220, 332, 472
BstMWI GCNNNNNNNGC 1 cut(s) 245
BstNI CCWGG 1 cut(s) 273
BstSCI CCNGG 1 cut(s) 271
BstV1I GCAGC 3 cut(s) 154, 251, 291
BstX2I RGATCY 2 cut(s) 220, 332
BstYI RGATCY 2 cut(s) 220, 332
Bsu15I ATCGAT 1 cut(s) 354
BsuRI GGCC 2 cut(s) 405, 435
BsuTUI ATCGAT 1 cut(s) 354
BtsI GCAGTG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 72
BveI ACCTGC 2 cut(s) 100, 335
CciI TCATGA 2 cut(s) 18, 409
Cfr13I GGNCC 1 cut(s) 89
ClaI ATCGAT 1 cut(s) 354
Csp6I GTAC 3 cut(s) 269, 445, 486
CviAII CATG 3 cut(s) 19, 151, 410
CviJI RGCY 6 cut(s) 80, 194, 304, 381, 405, 435
CviKI_1 RGCY 6 cut(s) 80, 194, 304, 381, 405, 435
CviQI GTAC 3 cut(s) 269, 445, 486
DdeI CTNAG 3 cut(s) 74, 189, 495
DpnI GATC 3 cut(s) 222, 334, 474
DpnII GATC 3 cut(s) 220, 332, 472
EaeI YGGCCR 1 cut(s) 403
Eco47I GGWCC 1 cut(s) 89
EcoO109I RGGNCCY 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 271
Esp3I CGTCTC 1 cut(s) 15
FaeI CATG 3 cut(s) 22, 154, 413
FatI CATG 3 cut(s) 18, 150, 409
Fnu4HI GCNGC 4 cut(s) 63, 143, 240, 305
Fsp4HI GCNGC 4 cut(s) 63, 143, 240, 305
FspBI CTAG 2 cut(s) 363, 437
GluI GCNGC 4 cut(s) 63, 143, 240, 305
GsaI CCCAGC 1 cut(s) 385
HaeIII GGCC 2 cut(s) 405, 435
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 3 cut(s) 22, 154, 413
HphI GGTGA 4 cut(s) 25, 97, 165, 467
Hpy188III TCNNGA 3 cut(s) 19, 224, 410
Hpy99I CGWCG 1 cut(s) 10
HpyCH4III ACNGT 2 cut(s) 31, 416
HpyCH4V TGCA 3 cut(s) 142, 239, 248
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
HpyF3I CTNAG 3 cut(s) 74, 189, 495
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 3 cut(s) 22, 154, 413
Kzo9I GATC 3 cut(s) 220, 332, 472
Lsp1109I GCAGC 3 cut(s) 154, 251, 291
MaeI CTAG 2 cut(s) 363, 437
MaeIII GTNAC 2 cut(s) 31, 38
MalI GATC 3 cut(s) 222, 334, 474
MboI GATC 3 cut(s) 220, 332, 472
MboII GAAGA 1 cut(s) 327
MflI RGATCY 2 cut(s) 220, 332
MlsI TGGCCA 1 cut(s) 405
MluCI AATT 1 cut(s) 368
MluNI TGGCCA 1 cut(s) 405
MnlI CCTC 7 cut(s) 43, 81, 118, 178, 181, 282, 285
Mox20I TGGCCA 1 cut(s) 405
MscI TGGCCA 1 cut(s) 405
MseI TTAA 4 cut(s) 162, 372, 395, 449
Msp20I TGGCCA 1 cut(s) 405
MspR9I CCNGG 1 cut(s) 273
MvaI CCWGG 1 cut(s) 273
MwoI GCNNNNNNNGC 1 cut(s) 245
NdeII GATC 3 cut(s) 220, 332, 472
NlaIII CATG 3 cut(s) 22, 154, 413
NlaIV GGNNCC 1 cut(s) 349
NmuCI GTSAC 1 cut(s) 31
PagI TCATGA 2 cut(s) 18, 409
PaqCI CACCTGC 1 cut(s) 335
PflMI CCANNNNNTGG 1 cut(s) 321
PkrI GCNGC 4 cut(s) 64, 144, 241, 306
PpuMI RGGWCCY 1 cut(s) 89
Psp5II RGGWCCY 1 cut(s) 89
Psp6I CCWGG 1 cut(s) 271
PspFI CCCAGC 1 cut(s) 381
PspGI CCWGG 1 cut(s) 271
PspN4I GGNNCC 1 cut(s) 349
PspPI GGNCC 1 cut(s) 89
PspPPI RGGWCCY 1 cut(s) 89
PsuI RGATCY 2 cut(s) 220, 332
RsaI GTAC 3 cut(s) 270, 446, 487
RsaNI GTAC 3 cut(s) 269, 445, 486
SaqAI TTAA 4 cut(s) 162, 372, 395, 449
SatI GCNGC 4 cut(s) 63, 143, 240, 305
Sau3AI GATC 3 cut(s) 220, 332, 472
Sau96I GGNCC 1 cut(s) 89
ScaI AGTACT 2 cut(s) 446, 487
ScrFI CCNGG 1 cut(s) 273
SetI ASST 9 cut(s) 38, 54, 94, 110, 217, 296, 306, 349, 457
SinI GGWCC 1 cut(s) 89
SmlI CTYRAG 1 cut(s) 478
SmoI CTYRAG 1 cut(s) 478
Sse9I AATT 1 cut(s) 368
SsiI CCGC 2 cut(s) 62, 179
SspMI CTAG 2 cut(s) 363, 437
StyD4I CCNGG 1 cut(s) 271
TaaI ACNGT 2 cut(s) 31, 416
TaqI TCGA 3 cut(s) 354, 418, 441
TasI AATT 1 cut(s) 368
TatI WGTACW 2 cut(s) 444, 485
TauI GCSGC 1 cut(s) 65
Tru1I TTAA 4 cut(s) 162, 372, 395, 449
Tru9I TTAA 4 cut(s) 162, 372, 395, 449
TscAI CASTG 1 cut(s) 72
TseFI GTSAC 1 cut(s) 31
TseI GCWGC 3 cut(s) 142, 239, 304
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 3 cut(s) 35, 91, 139
TspRI CASTG 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 321
VpaK11BI GGWCC 1 cut(s) 89
XapI RAATTY 1 cut(s) 368
XspI CTAG 2 cut(s) 363, 437
ZrmI AGTACT 2 cut(s) 446, 487
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.