Rmu_sc0006282.1_g000023

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006282.1
Physical Location & Seq
Forward (+)
79811 .. 81364
1554 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006282.1_g000023.1.cds

Sequence Viewer

Length: 504 bp
atggcgtcatctcttcttatgaaaccaacagtcagcagtaatagagatgaggtgtttgttgcagcagtgcctctaagagccgcaaaaggacctgcccagctcctcacctctactgcttactctctcaatctctgggatttgcagcacttcatggtcatcattaagccctcctcaccaccaccacattctcaggctttggtttttgattttcaacctaaagatcctgaaaacatatatgcagcacttgcagttctatctggtaaagcaataccaggagttattctaacaaggaagttatcgaagcttccaagaaccaaatgctggtttgttggatcttccaaagcaggtgccatcgataaagctagtgaatttaacaaagtctggaaaactcatctaagggttggccatcatgattgtcgaaactataccaatggcctagttgagtacttaacaggcgaaaagtatgtcttggatcgcttgagaagtactgatcctcagaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

167

Amino Acids

18.52

Weight (kDa)

9.7

Isoelectric Point (pI)

38.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 335
Acc36I ACCTGC 2 cut(s) 100, 335
AccB1I GGYRCC 1 cut(s) 347
AccB7I CCANNNNNTGG 1 cut(s) 321
AciI CCGC 1 cut(s) 81
AclWI GGATC 4 cut(s) 215, 340, 480, 485
AcoI YGGCCR 1 cut(s) 403
AcsI RAATTY 1 cut(s) 368
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 2 cut(s) 446, 487
AfiI CCNNNNNNNGG 1 cut(s) 321
AgsI TTSAA 1 cut(s) 212
AjnI CCWGG 1 cut(s) 271
AluBI AGCT 3 cut(s) 100, 304, 362
AluI AGCT 3 cut(s) 100, 304, 362
AlwI GGATC 4 cut(s) 215, 340, 480, 485
AoxI GGCC 2 cut(s) 403, 433
ApeKI GCWGC 3 cut(s) 62, 142, 239
ApoI RAATTY 1 cut(s) 368
ArsI GACNNNNNNTTYG 2 cut(s) 450, 482
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 2 cut(s) 97, 165
AvaII GGWCC 1 cut(s) 89
BalI TGGCCA 1 cut(s) 405
BanI GGYRCC 1 cut(s) 347
BbvI GCAGC 3 cut(s) 74, 154, 251
BccI CCATC 2 cut(s) 359, 414
BciT130I CCWGG 1 cut(s) 273
BfaI CTAG 2 cut(s) 363, 437
BfuAI ACCTGC 2 cut(s) 100, 335
BisI GCNGC 4 cut(s) 63, 81, 143, 240
BlsI GCNGC 4 cut(s) 64, 82, 144, 241
BmcAI AGTACT 2 cut(s) 446, 487
Bme1390I CCNGG 1 cut(s) 273
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 349
BmrFI CCNGG 1 cut(s) 273
BpuEI CTTGAG 1 cut(s) 499
Bsa29I ATCGAT 1 cut(s) 354
BsaHI GRCGYC 1 cut(s) 5
Bsc4I CCNNNNNNNGG 1 cut(s) 321
BseBI CCWGG 1 cut(s) 273
BseCI ATCGAT 1 cut(s) 354
BseLI CCNNNNNNNGG 1 cut(s) 321
BseMII CTCAG 1 cut(s) 203
BseRI GAGGAG 2 cut(s) 92, 160
BseXI GCAGC 3 cut(s) 74, 154, 251
BseYI CCCAGC 1 cut(s) 96
BshFI GGCC 2 cut(s) 405, 435
BshNI GGYRCC 1 cut(s) 347
BshVI ATCGAT 1 cut(s) 354
BslI CCNNNNNNNGG 1 cut(s) 321
BsnI GGCC 2 cut(s) 405, 435
Bsp143I GATC 4 cut(s) 220, 332, 472, 490
BspACI CCGC 1 cut(s) 81
BspANI GGCC 2 cut(s) 405, 435
BspCNI CTCAG 1 cut(s) 202
BspDI ATCGAT 1 cut(s) 354
BspHI TCATGA 1 cut(s) 409
BspLI GGNNCC 1 cut(s) 349
BspMI ACCTGC 2 cut(s) 100, 335
BspPI GGATC 4 cut(s) 215, 340, 480, 485
BspT107I GGYRCC 1 cut(s) 347
BssMI GATC 4 cut(s) 220, 332, 472, 490
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 273
Bst4CI ACNGT 1 cut(s) 31
Bst6I CTCTTC 1 cut(s) 18
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 245
BstDEI CTNAG 4 cut(s) 74, 189, 395, 495
BstKTI GATC 4 cut(s) 223, 335, 475, 493
BstMBI GATC 4 cut(s) 220, 332, 472, 490
BstMWI GCNNNNNNNGC 1 cut(s) 245
BstNI CCWGG 1 cut(s) 273
BstSCI CCNGG 1 cut(s) 271
BstV1I GCAGC 3 cut(s) 74, 154, 251
BstX2I RGATCY 2 cut(s) 220, 332
BstYI RGATCY 2 cut(s) 220, 332
Bsu15I ATCGAT 1 cut(s) 354
BsuRI GGCC 2 cut(s) 405, 435
BsuTUI ATCGAT 1 cut(s) 354
BtsI GCAGTG 1 cut(s) 72
BtsIMutI CAGTG 1 cut(s) 72
BveI ACCTGC 2 cut(s) 100, 335
CciI TCATGA 1 cut(s) 409
Cfr13I GGNCC 1 cut(s) 89
ClaI ATCGAT 1 cut(s) 354
Csp6I GTAC 2 cut(s) 445, 486
CviAII CATG 2 cut(s) 151, 410
CviJI RGCY 8 cut(s) 80, 100, 166, 194, 304, 362, 405, 435
CviKI_1 RGCY 8 cut(s) 80, 100, 166, 194, 304, 362, 405, 435
CviQI GTAC 2 cut(s) 445, 486
DdeI CTNAG 4 cut(s) 74, 189, 395, 495
DpnI GATC 4 cut(s) 222, 334, 474, 492
DpnII GATC 4 cut(s) 220, 332, 472, 490
EaeI YGGCCR 1 cut(s) 403
Eam1104I CTCTTC 1 cut(s) 18
EarI CTCTTC 1 cut(s) 18
Eco47I GGWCC 1 cut(s) 89
EcoO109I RGGNCCY 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 271
FaeI CATG 2 cut(s) 154, 413
FaiI YATR 8 cut(s) 20, 152, 233, 235, 237, 411, 426, 465
FalI AAGNNNNNCTT 2 cut(s) 452, 484
FatI CATG 2 cut(s) 150, 409
Fnu4HI GCNGC 4 cut(s) 63, 81, 143, 240
Fsp4HI GCNGC 4 cut(s) 63, 81, 143, 240
FspBI CTAG 2 cut(s) 363, 437
GluI GCNGC 4 cut(s) 63, 81, 143, 240
GsaI CCCAGC 1 cut(s) 100
HaeIII GGCC 2 cut(s) 405, 435
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 2 cut(s) 154, 413
HindIII AAGCTT 1 cut(s) 302
HphI GGTGA 2 cut(s) 97, 165
Hpy188I TCNGA 1 cut(s) 498
Hpy188III TCNNGA 3 cut(s) 224, 382, 410
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 4 cut(s) 62, 142, 239, 248
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
HpyF3I CTNAG 4 cut(s) 74, 189, 395, 495
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 2 cut(s) 154, 413
Kzo9I GATC 4 cut(s) 220, 332, 472, 490
LmnI GCTCC 1 cut(s) 105
Lsp1109I GCAGC 3 cut(s) 74, 154, 251
MaeI CTAG 2 cut(s) 363, 437
MalI GATC 4 cut(s) 222, 334, 474, 492
MboI GATC 4 cut(s) 220, 332, 472, 490
MboII GAAGA 2 cut(s) 5, 327
MflI RGATCY 2 cut(s) 220, 332
MlsI TGGCCA 1 cut(s) 405
MluCI AATT 1 cut(s) 368
MluNI TGGCCA 1 cut(s) 405
MmeI TCCRAC 1 cut(s) 310
MnlI CCTC 7 cut(s) 43, 81, 113, 118, 178, 181, 504
Mox20I TGGCCA 1 cut(s) 405
MscI TGGCCA 1 cut(s) 405
MseI TTAA 3 cut(s) 162, 372, 449
Msp20I TGGCCA 1 cut(s) 405
MspR9I CCNGG 1 cut(s) 273
MvaI CCWGG 1 cut(s) 273
MwoI GCNNNNNNNGC 1 cut(s) 245
NdeII GATC 4 cut(s) 220, 332, 472, 490
NlaIII CATG 2 cut(s) 154, 413
NlaIV GGNNCC 1 cut(s) 349
PagI TCATGA 1 cut(s) 409
PaqCI CACCTGC 1 cut(s) 335
PflMI CCANNNNNTGG 1 cut(s) 321
PkrI GCNGC 4 cut(s) 64, 82, 144, 241
PpuMI RGGWCCY 1 cut(s) 89
Psp5II RGGWCCY 1 cut(s) 89
Psp6I CCWGG 1 cut(s) 271
PspFI CCCAGC 1 cut(s) 96
PspGI CCWGG 1 cut(s) 271
PspN4I GGNNCC 1 cut(s) 349
PspPI GGNCC 1 cut(s) 89
PspPPI RGGWCCY 1 cut(s) 89
PsuI RGATCY 2 cut(s) 220, 332
RsaI GTAC 2 cut(s) 446, 487
RsaNI GTAC 2 cut(s) 445, 486
SaqAI TTAA 3 cut(s) 162, 372, 449
SatI GCNGC 4 cut(s) 63, 81, 143, 240
Sau3AI GATC 4 cut(s) 220, 332, 472, 490
Sau96I GGNCC 1 cut(s) 89
ScaI AGTACT 2 cut(s) 446, 487
ScrFI CCNGG 1 cut(s) 273
SetI ASST 8 cut(s) 54, 94, 102, 110, 217, 306, 349, 364
SinI GGWCC 1 cut(s) 89
SmlI CTYRAG 1 cut(s) 478
SmoI CTYRAG 1 cut(s) 478
Sse9I AATT 1 cut(s) 368
SsiI CCGC 1 cut(s) 81
SspMI CTAG 2 cut(s) 363, 437
StyD4I CCNGG 1 cut(s) 271
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 3 cut(s) 299, 354, 418
TasI AATT 1 cut(s) 368
TatI WGTACW 2 cut(s) 444, 485
TauI GCSGC 1 cut(s) 83
Tru1I TTAA 3 cut(s) 162, 372, 449
Tru9I TTAA 3 cut(s) 162, 372, 449
TscAI CASTG 1 cut(s) 72
TseI GCWGC 3 cut(s) 62, 142, 239
TspDTI ATGAA 2 cut(s) 35, 139
TspRI CASTG 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 321
VpaK11BI GGWCC 1 cut(s) 89
XapI RAATTY 1 cut(s) 368
XspI CTAG 2 cut(s) 363, 437
ZrmI AGTACT 2 cut(s) 446, 487
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.