pycom17g10260

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0004059
Physical Location & Seq
Forward (+)
7926661 .. 7927669
1009 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g10260.1

Sequence Viewer

Length: 384 bp
ATGATCTTTGGGCTGGAATTGAGTCAATTGACAAATGATTTCCACCAAGTCAATTTTTTCATTTTGGCAAACCAAATGGCCTCACAGCTCATTCAACCAACAGTGACCAAAGGAAGGGATGAAGTTTATGTTGCAGCTGTGCCTCTAAGAGCAAGAAAAGGAGATGCCCAGCTGCTTACATCTGCTGCTTATTCTCTCAATCTCTGGAATTTGCTGCATTTCATGGTTATTATCAAACCCTCTTCACCACCACCTGATTGTCAGGCCATGGTTTTCGATTTTCAACCTAAAGATCCTGAAAACATATATGTAGCCCTTGCAGTTCTATCTGGGAAAGCAATATCCGGTGAGCCTAGCTACGTACATCATCTACTACATCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

128

Amino Acids

14.13

Weight (kDa)

6.16

Isoelectric Point (pI)

30.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 287
AcsI RAATTY 1 cut(s) 208
AfaI GTAC 1 cut(s) 363
AfiI CCNNNNNNNGG 1 cut(s) 114
AgsI TTSAA 2 cut(s) 95, 284
AluBI AGCT 4 cut(s) 88, 137, 172, 357
AluI AGCT 4 cut(s) 88, 137, 172, 357
AlwI GGATC 1 cut(s) 287
AoxI GGCC 2 cut(s) 78, 264
ApeKI GCWGC 4 cut(s) 134, 172, 185, 214
ApoI RAATTY 1 cut(s) 208
AsuHPI GGTGA 2 cut(s) 237, 359
BbvI GCAGC 4 cut(s) 146, 159, 172, 201
BfaI CTAG 1 cut(s) 354
BisI GCNGC 4 cut(s) 135, 173, 186, 215
BlsI GCNGC 4 cut(s) 136, 174, 187, 216
BmsI GCATC 1 cut(s) 154
BsaAI YACGTR 1 cut(s) 361
BsaJI CCNNGG 1 cut(s) 267
BsaWI WCCGGW 1 cut(s) 344
Bsc4I CCNNNNNNNGG 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 267
BseGI GGATG 1 cut(s) 124
BseLI CCNNNNNNNGG 1 cut(s) 114
BseXI GCAGC 4 cut(s) 146, 159, 172, 201
BseYI CCCAGC 1 cut(s) 168
BshFI GGCC 2 cut(s) 80, 266
BsiSI CCGG 1 cut(s) 345
BslI CCNNNNNNNGG 1 cut(s) 114
BsnI GGCC 2 cut(s) 80, 266
Bsp143I GATC 2 cut(s) 3, 292
Bsp19I CCATGG 1 cut(s) 267
BspANI GGCC 2 cut(s) 80, 266
BspPI GGATC 1 cut(s) 287
BssECI CCNNGG 1 cut(s) 267
BssMI GATC 2 cut(s) 3, 292
BssT1I CCWWGG 1 cut(s) 267
Bst4CI ACNGT 1 cut(s) 103
Bst6I CTCTTC 1 cut(s) 247
BstBAI YACGTR 1 cut(s) 361
BstDEI CTNAG 1 cut(s) 146
BstDSI CCRYGG 1 cut(s) 267
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 2 cut(s) 6, 295
BstMBI GATC 2 cut(s) 3, 292
BstSNI TACGTA 1 cut(s) 361
BstV1I GCAGC 4 cut(s) 146, 159, 172, 201
BstX2I RGATCY 1 cut(s) 292
BstYI RGATCY 1 cut(s) 292
BsuRI GGCC 2 cut(s) 80, 266
BtgI CCRYGG 1 cut(s) 267
BtsCI GGATG 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 108
Csp6I GTAC 1 cut(s) 362
CviAII CATG 2 cut(s) 223, 268
CviJI RGCY 9 cut(s) 13, 80, 88, 137, 172, 266, 314, 352, 357
CviKI_1 RGCY 9 cut(s) 13, 80, 88, 137, 172, 266, 314, 352, 357
CviQI GTAC 1 cut(s) 362
DdeI CTNAG 1 cut(s) 146
DpnI GATC 2 cut(s) 5, 294
DpnII GATC 2 cut(s) 3, 292
Eam1104I CTCTTC 1 cut(s) 247
EarI CTCTTC 1 cut(s) 247
Eco105I TACGTA 1 cut(s) 361
Eco130I CCWWGG 1 cut(s) 267
EcoT14I CCWWGG 1 cut(s) 267
ErhI CCWWGG 1 cut(s) 267
FaeI CATG 2 cut(s) 226, 271
FaiI YATR 6 cut(s) 129, 224, 269, 305, 307, 309
FatI CATG 2 cut(s) 222, 267
Fnu4HI GCNGC 4 cut(s) 135, 173, 186, 215
FokI GGATG 1 cut(s) 131
Fsp4HI GCNGC 4 cut(s) 135, 173, 186, 215
FspBI CTAG 1 cut(s) 354
GluI GCNGC 4 cut(s) 135, 173, 186, 215
GsaI CCCAGC 1 cut(s) 172
HaeIII GGCC 2 cut(s) 80, 266
HapII CCGG 1 cut(s) 345
Hin1II CATG 2 cut(s) 226, 271
HinfI GANTC 1 cut(s) 22
HpaII CCGG 1 cut(s) 345
HphI GGTGA 2 cut(s) 237, 359
Hpy188III TCNNGA 2 cut(s) 205, 296
HpyAV CCTTC 1 cut(s) 108
HpyCH4III ACNGT 1 cut(s) 103
HpyCH4IV ACGT 1 cut(s) 360
HpyCH4V TGCA 3 cut(s) 134, 217, 320
HpyF3I CTNAG 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 360
Hsp92II CATG 2 cut(s) 226, 271
Kzo9I GATC 2 cut(s) 3, 292
LpnPI CCDG 7 cut(s) 182, 190, 248, 267, 309, 315, 358
Lsp1109I GCAGC 4 cut(s) 146, 159, 172, 201
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 354
MaeII ACGT 1 cut(s) 360
MaeIII GTNAC 1 cut(s) 103
MalI GATC 2 cut(s) 5, 294
MboI GATC 2 cut(s) 3, 292
MboII GAAGA 1 cut(s) 234
MfeI CAATTG 1 cut(s) 26
MflI RGATCY 1 cut(s) 292
MluCI AATT 4 cut(s) 17, 26, 52, 208
MlyI GAGTC 1 cut(s) 31
MnlI CCTC 3 cut(s) 91, 153, 250
MspA1I CMGCKG 2 cut(s) 137, 172
MspI CCGG 1 cut(s) 345
MunI CAATTG 1 cut(s) 26
NcoI CCATGG 1 cut(s) 267
NdeII GATC 2 cut(s) 3, 292
NlaIII CATG 2 cut(s) 226, 271
NmuCI GTSAC 1 cut(s) 103
PkrI GCNGC 4 cut(s) 136, 174, 187, 216
PleI GAGTC 1 cut(s) 30
PpsI GAGTC 1 cut(s) 30
Ppu21I YACGTR 1 cut(s) 361
PspFI CCCAGC 1 cut(s) 168
PsuI RGATCY 1 cut(s) 292
PvuII CAGCTG 2 cut(s) 137, 172
RsaI GTAC 1 cut(s) 363
RsaNI GTAC 1 cut(s) 362
SatI GCNGC 4 cut(s) 135, 173, 186, 215
Sau3AI GATC 2 cut(s) 3, 292
SchI GAGTC 1 cut(s) 31
SetI ASST 7 cut(s) 90, 139, 174, 256, 289, 359, 363
SfaNI GCATC 1 cut(s) 154
SnaBI TACGTA 1 cut(s) 361
Sse9I AATT 4 cut(s) 17, 26, 52, 208
SspMI CTAG 1 cut(s) 354
StyI CCWWGG 1 cut(s) 267
TaaI ACNGT 1 cut(s) 103
TaiI ACGT 1 cut(s) 363
TaqI TCGA 1 cut(s) 276
TasI AATT 4 cut(s) 17, 26, 52, 208
TscAI CASTG 1 cut(s) 108
TseFI GTSAC 1 cut(s) 103
TseI GCWGC 4 cut(s) 134, 172, 185, 214
Tsp45I GTSAC 1 cut(s) 103
TspDTI ATGAA 3 cut(s) 49, 135, 211
TspRI CASTG 1 cut(s) 108
XapI RAATTY 1 cut(s) 208
XspI CTAG 1 cut(s) 354
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.