MD17G1110300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Forward (+)
9500095 .. 9501901
1807 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1110300.v1.1.491

Sequence Viewer

Length: 162 bp
ATGGTTATTATCAAACCCTCTTCATCACCACCTGATTGTCAGGCAATGGTTTTCGATTTTCAACCTAAAGATCCTGAAAACATATATGTAGCCCTTGCAGTTCTATCCGGGAAAGCAACATCCGGTGAGCCTAGCTACGTACATCATCTACTACATCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.78

Weight (kDa)

5.75

Isoelectric Point (pI)

47.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 65
AfaI GTAC 1 cut(s) 141
AgsI TTSAA 1 cut(s) 62
AluBI AGCT 1 cut(s) 135
AluI AGCT 1 cut(s) 135
AlwI GGATC 1 cut(s) 65
AsuC2I CCSGG 1 cut(s) 109
AsuHPI GGTGA 2 cut(s) 18, 137
BcnI CCSGG 1 cut(s) 109
BfaI CTAG 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 109
BmrFI CCNGG 1 cut(s) 109
BpuMI CCSGG 1 cut(s) 109
BsaAI YACGTR 1 cut(s) 139
BsaWI WCCGGW 1 cut(s) 122
Bse3DI GCAATG 1 cut(s) 51
BseGI GGATG 1 cut(s) 119
BseMI GCAATG 1 cut(s) 51
BsiSI CCGG 2 cut(s) 108, 123
Bsp143I GATC 1 cut(s) 70
BspPI GGATC 1 cut(s) 65
BsrDI GCAATG 1 cut(s) 51
BssMI GATC 1 cut(s) 70
Bst6I CTCTTC 1 cut(s) 25
BstBAI YACGTR 1 cut(s) 139
BstF5I GGATG 1 cut(s) 119
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstSCI CCNGG 1 cut(s) 107
BstSNI TACGTA 1 cut(s) 139
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
BtsCI GGATG 1 cut(s) 119
Csp6I GTAC 1 cut(s) 140
CviJI RGCY 3 cut(s) 92, 130, 135
CviKI_1 RGCY 3 cut(s) 92, 130, 135
CviQI GTAC 1 cut(s) 140
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eam1104I CTCTTC 1 cut(s) 25
EarI CTCTTC 1 cut(s) 25
Eco105I TACGTA 1 cut(s) 139
FaiI YATR 3 cut(s) 83, 85, 87
FokI GGATG 1 cut(s) 106
FspBI CTAG 1 cut(s) 132
HapII CCGG 2 cut(s) 108, 123
HpaII CCGG 2 cut(s) 108, 123
HphI GGTGA 2 cut(s) 18, 137
Hpy188III TCNNGA 1 cut(s) 74
HpyCH4IV ACGT 1 cut(s) 138
HpyCH4V TGCA 1 cut(s) 98
HpySE526I ACGT 1 cut(s) 138
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 5 cut(s) 26, 45, 87, 121, 136
MaeI CTAG 1 cut(s) 132
MaeII ACGT 1 cut(s) 138
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 1 cut(s) 12
MflI RGATCY 1 cut(s) 70
MnlI CCTC 1 cut(s) 28
MspI CCGG 2 cut(s) 108, 123
MspR9I CCNGG 1 cut(s) 109
NciI CCSGG 1 cut(s) 109
NdeII GATC 1 cut(s) 70
PfoI TCCNGGA 1 cut(s) 107
Ppu21I YACGTR 1 cut(s) 139
PsuI RGATCY 1 cut(s) 70
RsaI GTAC 1 cut(s) 141
RsaNI GTAC 1 cut(s) 140
Sau3AI GATC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 109
SetI ASST 4 cut(s) 34, 67, 137, 141
SgeI CNNG 8 cut(s) 44, 53, 86, 107, 120, 121, 135, 144
SnaBI TACGTA 1 cut(s) 139
SspMI CTAG 1 cut(s) 132
StyD4I CCNGG 1 cut(s) 107
TaiI ACGT 1 cut(s) 141
TaqI TCGA 1 cut(s) 54
TspDTI ATGAA 1 cut(s) 12
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.