FvH4_6g53930

Pollen proteins Ole e I like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0015014
Physical Location & Seq
Forward (+)
39457229 .. 39458605
1377 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g53930.t1

Sequence Viewer

Length: 525 bp
ATGAACTCAGTAATTCTCTTTCTTATTTCCTCTATGTTTTTCCAGTCAGTTTTTCTGGGAGGTGAATCAGCAAGAGCTAAGGTGGTAAAAGGCAACTCCCAGATCATTGTGATGGGCCTTGTTTACTGTGACATCTGCTCCAACAACACCTTCTCCACTCACAGCTACTTCATATCAGGTGCTGAGGTTAGAATAGACTGCATGTTCAAAGCAGTGTCACCAAGAATTGCAGAACACATATCATTCTCAGCAAATAGAACTACAAACAGGTATGGGGTGTACAAGTTGGAAATCCCATCTGTTGAGGGAATCAAATGTGCAGAGGATTCTGCAATAGTTTCTTCCTGCCAGGCAAGCTTAATGTGGAGTGGAACTCCAGCTTGTAATGTTCCTGGTTTCAAATCCACATCAGATGAAATAGCAGTCAAATCAAAGCAAGCTAATCTCTGCATCTACAGCCTTAATGCTTTGAATTTCAGACCATCAAGGAGAGAGATTGGCTTATGTGGCAAGAAACAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pollen_Ole_e_I

Protein Analysis

175

Amino Acids

19.0

Weight (kDa)

8.95

Isoelectric Point (pI)

36.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 37 - 134 4.9e-20 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015014)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26960 AT5G41050
fragaria_vesca FvH4_6g53930
malus_domestica MD17G1011000.v1.1
prunus_persica Prupe.3G309900_v2.0.a1
pyrus_communis pycom17g00570
rosa_chinensis RchiOBHm_Chr2g0176091
rosa_laevigata RLG00000022380
rosa_multiflora Rmu_sc0009879.1_g000002
rosa_roxburghii Rroxscaffold_2G00076780
rosa_rugosa Rorug02G0590400
rosa_samantha Rh2AG669200 Rh2BG680800 Rh2CG643700 Rh2DG694500
rosa_wichuraiana Rw2G054890

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 472
AfaI GTAC 1 cut(s) 281
AgsI TTSAA 3 cut(s) 208, 400, 472
AjnI CCWGG 2 cut(s) 348, 391
AjuI GAANNNNNNNTTGG 2 cut(s) 134, 166
AluBI AGCT 5 cut(s) 77, 165, 357, 380, 440
AluI AGCT 5 cut(s) 77, 165, 357, 380, 440
AlwNI CAGNNNCTG 1 cut(s) 182
AoxI GGCC 1 cut(s) 115
ApoI RAATTY 1 cut(s) 472
AspS9I GGNCC 1 cut(s) 115
AsuHPI GGTGA 2 cut(s) 74, 210
BbvCI CCTCAGC 1 cut(s) 183
BccI CCATC 3 cut(s) 106, 304, 490
BciT130I CCWGG 2 cut(s) 350, 393
BfmI CTRYAG 1 cut(s) 454
Bme1390I CCNGG 2 cut(s) 350, 393
BmgT120I GGNCC 1 cut(s) 115
BmrFI CCNGG 2 cut(s) 350, 393
BmsI GCATC 1 cut(s) 459
BplI GAGNNNNNCTC 2 cut(s) 358, 390
BpmI CTGGAG 1 cut(s) 360
Bpu10I CCTNAGC 2 cut(s) 78, 183
BsaXI ACNNNNNCTCC 4 cut(s) 122, 137, 152, 167
Bse1I ACTGG 1 cut(s) 43
BseBI CCWGG 2 cut(s) 350, 393
BseMII CTCAG 3 cut(s) 21, 174, 261
BseNI ACTGG 1 cut(s) 43
BsgI GTGCAG 1 cut(s) 339
BshFI GGCC 1 cut(s) 117
BsnI GGCC 1 cut(s) 117
Bsp1407I TGTACA 1 cut(s) 279
Bsp143I GATC 1 cut(s) 102
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 3 cut(s) 20, 175, 260
BsrGI TGTACA 1 cut(s) 279
BsrI ACTGG 1 cut(s) 43
BssMI GATC 1 cut(s) 102
Bst2UI CCWGG 2 cut(s) 350, 393
Bst4CI ACNGT 1 cut(s) 128
BstAUI TGTACA 1 cut(s) 279
BstC8I GCNNGC 2 cut(s) 355, 438
BstDEI CTNAG 4 cut(s) 7, 78, 183, 247
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstMWI GCNNNNNNNGC 3 cut(s) 354, 456, 507
BstNI CCWGG 2 cut(s) 350, 393
BstNSI RCATGY 1 cut(s) 205
BstSCI CCNGG 2 cut(s) 348, 391
BstSFI CTRYAG 1 cut(s) 454
BsuRI GGCC 1 cut(s) 117
BtsI GCAGTG 1 cut(s) 219
BtsIMutI CAGTG 1 cut(s) 219
Cac8I GCNNGC 2 cut(s) 355, 438
CaiI CAGNNNCTG 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 115
Csp6I GTAC 1 cut(s) 280
CviAII CATG 1 cut(s) 202
CviJI RGCY 8 cut(s) 77, 117, 165, 357, 380, 440, 459, 501
CviKI_1 RGCY 8 cut(s) 77, 117, 165, 357, 380, 440, 459, 501
CviQI GTAC 1 cut(s) 280
DdeI CTNAG 4 cut(s) 7, 78, 183, 247
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
EcoRII CCWGG 2 cut(s) 348, 391
FaeI CATG 1 cut(s) 205
FaiI YATR 6 cut(s) 35, 173, 203, 239, 273, 505
FatI CATG 1 cut(s) 201
GsuI CTGGAG 1 cut(s) 360
HaeIII GGCC 1 cut(s) 117
Hin1II CATG 1 cut(s) 205
HindIII AAGCTT 1 cut(s) 355
HinfI GANTC 3 cut(s) 65, 309, 326
HphI GGTGA 2 cut(s) 74, 210
Hpy166II GTNNAC 2 cut(s) 124, 280
Hpy188I TCNGA 2 cut(s) 412, 479
Hpy8I GTNNAC 2 cut(s) 124, 280
HpyAV CCTTC 1 cut(s) 160
HpyCH4III ACNGT 1 cut(s) 128
HpyCH4V TGCA 5 cut(s) 201, 230, 320, 332, 450
HpyF10VI GCNNNNNNNGC 3 cut(s) 354, 456, 507
HpyF3I CTNAG 4 cut(s) 7, 78, 183, 247
Hsp92II CATG 1 cut(s) 205
Kzo9I GATC 1 cut(s) 102
LmnI GCTCC 1 cut(s) 143
LweI GCATC 1 cut(s) 459
MaeIII GTNAC 2 cut(s) 128, 216
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MboII GAAGA 1 cut(s) 333
MluCI AATT 3 cut(s) 12, 225, 472
MmeI TCCRAC 2 cut(s) 165, 267
MnlI CCTC 5 cut(s) 40, 53, 178, 298, 316
MseI TTAA 2 cut(s) 359, 462
MslI CAYNNNNRTG 1 cut(s) 110
MspR9I CCNGG 2 cut(s) 350, 393
MvaI CCWGG 2 cut(s) 350, 393
MwoI GCNNNNNNNGC 3 cut(s) 354, 456, 507
NdeII GATC 1 cut(s) 102
NlaIII CATG 1 cut(s) 205
NmuCI GTSAC 2 cut(s) 128, 216
NspI RCATGY 1 cut(s) 205
PfeI GAWTC 3 cut(s) 65, 309, 326
Psp6I CCWGG 2 cut(s) 348, 391
PspGI CCWGG 2 cut(s) 348, 391
PspPI GGNCC 1 cut(s) 115
PstNI CAGNNNCTG 1 cut(s) 182
RsaI GTAC 1 cut(s) 281
RsaNI GTAC 1 cut(s) 280
RseI CAYNNNNRTG 1 cut(s) 110
SaqAI TTAA 2 cut(s) 359, 462
Sau3AI GATC 1 cut(s) 102
Sau96I GGNCC 1 cut(s) 115
ScrFI CCNGG 2 cut(s) 350, 393
SfaNI GCATC 1 cut(s) 459
SfcI CTRYAG 1 cut(s) 454
SmiMI CAYNNNNRTG 1 cut(s) 110
Sse9I AATT 3 cut(s) 12, 225, 472
StyD4I CCNGG 2 cut(s) 348, 391
TaaI ACNGT 1 cut(s) 128
TasI AATT 3 cut(s) 12, 225, 472
TatI WGTACW 1 cut(s) 279
TfiI GAWTC 3 cut(s) 65, 309, 326
Tru1I TTAA 2 cut(s) 359, 462
Tru9I TTAA 2 cut(s) 359, 462
TscAI CASTG 1 cut(s) 219
TseFI GTSAC 2 cut(s) 128, 216
Tsp45I GTSAC 2 cut(s) 128, 216
TspDTI ATGAA 3 cut(s) 17, 160, 429
TspRI CASTG 1 cut(s) 219
XapI RAATTY 1 cut(s) 472
XceI RCATGY 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.