Rh2BG680800

Pollen proteins Ole e I like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
89049884 .. 89051674
1791 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG680800.1

Sequence Viewer

Length: 522 bp
ATGAATCCAGTAATTCTCTTTCTTATTTCCTCTATGTTTTTTCAGTCAGCTATTCTGGGAGGTGAATCAGCAAGGGCAGTAAAAGGTAACTCCCAGATTATTGTAATGGGCCTTGTTTACTGTGACATCTGCTCCAACAACACCTTCTCCCCTCACAGCTACTTCATTCCAGGTGCTGAGGTTAAAATAGATTGCATATTCAAAGCAGTGTCACCAAGAATTGCAGAACACATATCATTCTCAGCGAATAGAACTACAAACAGGTATGGGGTGTACAAGTTGGAAATCCCATCAGTTGAGGGAATCAAATGTGCAGAAGATTCTGCGATAGTTTCTTCCTGCCAGGCAAGCTTAATGCGGAGTGGATCTCCAGCTTGTAATGTTCCTGGTTACAAATCCACATCAGATGAAATAGCAATCAAATCAAAGGAAGCTAATCTCTGCATCTACAGCCTCAATGCTTTGAATTTCAGACCATCAAGGAGAGACATTGCCTTATGTGGCAAGAAAAAAATTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

18.8

Weight (kDa)

8.93

Isoelectric Point (pI)

40.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 35 - 133 1e-19 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015014)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26960 AT5G41050
fragaria_vesca FvH4_6g53930
malus_domestica MD17G1011000.v1.1
prunus_persica Prupe.3G309900_v2.0.a1
pyrus_communis pycom17g00570
rosa_chinensis RchiOBHm_Chr2g0176091
rosa_laevigata RLG00000022380
rosa_multiflora Rmu_sc0009879.1_g000002
rosa_roxburghii Rroxscaffold_2G00076780
rosa_rugosa Rorug02G0590400
rosa_samantha Rh2AG669200 Rh2BG680800 Rh2CG643700 Rh2DG694500
rosa_wichuraiana Rw2G054890

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 358
AclWI GGATC 1 cut(s) 373
AcsI RAATTY 1 cut(s) 466
AfaI GTAC 1 cut(s) 275
AgsI TTSAA 2 cut(s) 202, 466
AjnI CCWGG 3 cut(s) 169, 342, 385
AjuI GAANNNNNNNTTGG 2 cut(s) 128, 160
AluBI AGCT 5 cut(s) 50, 159, 351, 374, 434
AluI AGCT 5 cut(s) 50, 159, 351, 374, 434
Alw26I GTCTC 1 cut(s) 480
AlwI GGATC 1 cut(s) 373
AlwNI CAGNNNCTG 1 cut(s) 176
AoxI GGCC 1 cut(s) 109
ApoI RAATTY 1 cut(s) 466
AseI ATTAAT 1 cut(s) 516
AspS9I GGNCC 1 cut(s) 109
AsuHPI GGTGA 2 cut(s) 74, 204
BbvCI CCTCAGC 1 cut(s) 177
BccI CCATC 2 cut(s) 298, 484
BciT130I CCWGG 3 cut(s) 171, 344, 387
BcoDI GTCTC 1 cut(s) 480
BfmI CTRYAG 1 cut(s) 448
Bme1390I CCNGG 3 cut(s) 171, 344, 387
BmgT120I GGNCC 1 cut(s) 109
BmrFI CCNGG 3 cut(s) 171, 344, 387
BmsI GCATC 1 cut(s) 453
BplI GAGNNNNNCTC 2 cut(s) 352, 384
BpmI CTGGAG 1 cut(s) 354
Bpu10I CCTNAGC 1 cut(s) 177
BsaXI ACNNNNNCTCC 4 cut(s) 116, 131, 146, 161
Bse1I ACTGG 1 cut(s) 8
Bse3DI GCAATG 1 cut(s) 489
BseBI CCWGG 3 cut(s) 171, 344, 387
BseMI GCAATG 1 cut(s) 489
BseMII CTCAG 2 cut(s) 168, 255
BseNI ACTGG 1 cut(s) 8
BsgI GTGCAG 1 cut(s) 333
BshFI GGCC 1 cut(s) 111
BsmAI GTCTC 1 cut(s) 480
BsnI GGCC 1 cut(s) 111
Bsp1407I TGTACA 1 cut(s) 273
Bsp143I GATC 1 cut(s) 365
BspACI CCGC 1 cut(s) 358
BspANI GGCC 1 cut(s) 111
BspCNI CTCAG 2 cut(s) 169, 254
BspPI GGATC 1 cut(s) 373
BsrDI GCAATG 1 cut(s) 489
BsrGI TGTACA 1 cut(s) 273
BsrI ACTGG 1 cut(s) 8
BssMI GATC 1 cut(s) 365
Bst2UI CCWGG 3 cut(s) 171, 344, 387
Bst4CI ACNGT 1 cut(s) 122
BstAUI TGTACA 1 cut(s) 273
BstC8I GCNNGC 1 cut(s) 349
BstDEI CTNAG 2 cut(s) 177, 241
BstKTI GATC 1 cut(s) 368
BstMAI GTCTC 1 cut(s) 480
BstMBI GATC 1 cut(s) 365
BstMWI GCNNNNNNNGC 2 cut(s) 348, 450
BstNI CCWGG 3 cut(s) 171, 344, 387
BstSCI CCNGG 3 cut(s) 169, 342, 385
BstSFI CTRYAG 1 cut(s) 448
BstX2I RGATCY 1 cut(s) 365
BstYI RGATCY 1 cut(s) 365
BsuRI GGCC 1 cut(s) 111
BtsI GCAGTG 1 cut(s) 213
BtsIMutI CAGTG 1 cut(s) 213
Cac8I GCNNGC 1 cut(s) 349
CaiI CAGNNNCTG 1 cut(s) 176
Cfr13I GGNCC 1 cut(s) 109
Csp6I GTAC 1 cut(s) 274
CviJI RGCY 7 cut(s) 50, 111, 159, 351, 374, 434, 453
CviKI_1 RGCY 7 cut(s) 50, 111, 159, 351, 374, 434, 453
CviQI GTAC 1 cut(s) 274
DdeI CTNAG 2 cut(s) 177, 241
DpnI GATC 1 cut(s) 367
DpnII GATC 1 cut(s) 365
EcoRII CCWGG 3 cut(s) 169, 342, 385
FaiI YATR 5 cut(s) 35, 197, 233, 267, 499
GsuI CTGGAG 1 cut(s) 354
HaeIII GGCC 1 cut(s) 111
HindIII AAGCTT 1 cut(s) 349
HinfI GANTC 4 cut(s) 4, 65, 303, 320
HphI GGTGA 2 cut(s) 74, 204
Hpy166II GTNNAC 2 cut(s) 118, 274
Hpy188I TCNGA 2 cut(s) 406, 473
Hpy8I GTNNAC 2 cut(s) 118, 274
HpyAV CCTTC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 122
HpyCH4V TGCA 4 cut(s) 195, 224, 314, 444
HpyF10VI GCNNNNNNNGC 2 cut(s) 348, 450
HpyF3I CTNAG 2 cut(s) 177, 241
Kzo9I GATC 1 cut(s) 365
LmnI GCTCC 1 cut(s) 137
LweI GCATC 1 cut(s) 453
MaeIII GTNAC 4 cut(s) 86, 122, 210, 389
MalI GATC 1 cut(s) 367
MboI GATC 1 cut(s) 365
MboII GAAGA 2 cut(s) 327, 329
MflI RGATCY 1 cut(s) 365
MluCI AATT 5 cut(s) 12, 219, 466, 513, 517
MmeI TCCRAC 2 cut(s) 159, 261
MnlI CCTC 6 cut(s) 40, 53, 162, 172, 292, 464
MseI TTAA 3 cut(s) 183, 353, 516
MspR9I CCNGG 3 cut(s) 171, 344, 387
MvaI CCWGG 3 cut(s) 171, 344, 387
MwoI GCNNNNNNNGC 2 cut(s) 348, 450
NdeII GATC 1 cut(s) 365
NmuCI GTSAC 2 cut(s) 122, 210
PfeI GAWTC 4 cut(s) 4, 65, 303, 320
PshBI ATTAAT 1 cut(s) 516
Psp6I CCWGG 3 cut(s) 169, 342, 385
PspGI CCWGG 3 cut(s) 169, 342, 385
PspPI GGNCC 1 cut(s) 109
PstNI CAGNNNCTG 1 cut(s) 176
PsuI RGATCY 1 cut(s) 365
RsaI GTAC 1 cut(s) 275
RsaNI GTAC 1 cut(s) 274
SaqAI TTAA 3 cut(s) 183, 353, 516
Sau3AI GATC 1 cut(s) 365
Sau96I GGNCC 1 cut(s) 109
ScrFI CCNGG 3 cut(s) 171, 344, 387
SfaNI GCATC 1 cut(s) 453
SfcI CTRYAG 1 cut(s) 448
Sse9I AATT 5 cut(s) 12, 219, 466, 513, 517
SsiI CCGC 1 cut(s) 358
StyD4I CCNGG 3 cut(s) 169, 342, 385
TaaI ACNGT 1 cut(s) 122
TasI AATT 5 cut(s) 12, 219, 466, 513, 517
TatI WGTACW 1 cut(s) 273
TfiI GAWTC 4 cut(s) 4, 65, 303, 320
Tru1I TTAA 3 cut(s) 183, 353, 516
Tru9I TTAA 3 cut(s) 183, 353, 516
TscAI CASTG 1 cut(s) 213
TseFI GTSAC 2 cut(s) 122, 210
Tsp45I GTSAC 2 cut(s) 122, 210
TspDTI ATGAA 3 cut(s) 17, 154, 423
TspRI CASTG 1 cut(s) 213
VspI ATTAAT 1 cut(s) 516
XapI RAATTY 1 cut(s) 466
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.