RLG00000022380

Pollen proteins Ole e I like

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Forward (+)
82990906 .. 82991403
498 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000022380

Sequence Viewer

Length: 417 bp
ATGGGCCTTGTTTACTGTGACATCTGCTCCAACAACACCTTCTCCACTCACAGCTACTTCATTCCAGGTGCTGAGGTTAAAATAGATTGCATATTCAAAGCAGTGTCACCAAGAATTGCAGAACACATATCATTCTCAGCGAATAGAACTACAAACAGGTATGGGGTGTACAAGTTGGAAATCCCATCAGTTGAGGGAATCAAATGTGCAGAAGATTCTGCGATAGTTTCTTCCTGCCAGGCAAGCTTAATGCGGAGTGGATCTCCAGCTTGTAATGTTCCTGGTTACAAATCCACATCAGATGAAATAGCAATCAAATCAAAGGAAGCTAATCTCTGCATCTACAGCCTAAATGCTTTGAATTACAGACCATCAAGGAGAGACATTGCCTTATGTGGCAAGAAAAAAATTAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.1

Weight (kDa)

8.79

Isoelectric Point (pI)

34.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pollen_Ole_e_1 PF01190 1 - 98 9.2e-20 Pollen protein Ole e 1 like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015014)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G26960 AT5G41050
fragaria_vesca FvH4_6g53930
malus_domestica MD17G1011000.v1.1
prunus_persica Prupe.3G309900_v2.0.a1
pyrus_communis pycom17g00570
rosa_chinensis RchiOBHm_Chr2g0176091
rosa_laevigata RLG00000022380
rosa_multiflora Rmu_sc0009879.1_g000002
rosa_roxburghii Rroxscaffold_2G00076780
rosa_rugosa Rorug02G0590400
rosa_samantha Rh2AG669200 Rh2BG680800 Rh2CG643700 Rh2DG694500
rosa_wichuraiana Rw2G054890

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 253
AclWI GGATC 1 cut(s) 268
AfaI GTAC 1 cut(s) 170
AgsI TTSAA 2 cut(s) 97, 361
AjnI CCWGG 3 cut(s) 64, 237, 280
AjuI GAANNNNNNNTTGG 2 cut(s) 23, 55
AluBI AGCT 4 cut(s) 54, 246, 269, 329
AluI AGCT 4 cut(s) 54, 246, 269, 329
Alw26I GTCTC 1 cut(s) 375
AlwI GGATC 1 cut(s) 268
AlwNI CAGNNNCTG 1 cut(s) 71
AoxI GGCC 1 cut(s) 4
AseI ATTAAT 1 cut(s) 411
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 99
BbvCI CCTCAGC 1 cut(s) 72
BccI CCATC 2 cut(s) 193, 379
BciT130I CCWGG 3 cut(s) 66, 239, 282
BcoDI GTCTC 1 cut(s) 375
BfmI CTRYAG 1 cut(s) 343
Bme1390I CCNGG 3 cut(s) 66, 239, 282
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 3 cut(s) 66, 239, 282
BmsI GCATC 1 cut(s) 348
BplI GAGNNNNNCTC 2 cut(s) 247, 279
BpmI CTGGAG 1 cut(s) 249
Bpu10I CCTNAGC 1 cut(s) 72
BsaXI ACNNNNNCTCC 4 cut(s) 11, 26, 41, 56
Bse3DI GCAATG 1 cut(s) 384
BseBI CCWGG 3 cut(s) 66, 239, 282
BseMI GCAATG 1 cut(s) 384
BseMII CTCAG 2 cut(s) 63, 150
BsgI GTGCAG 1 cut(s) 228
BshFI GGCC 1 cut(s) 6
BsmAI GTCTC 1 cut(s) 375
BsnI GGCC 1 cut(s) 6
Bsp1407I TGTACA 1 cut(s) 168
Bsp143I GATC 1 cut(s) 260
BspACI CCGC 1 cut(s) 253
BspANI GGCC 1 cut(s) 6
BspCNI CTCAG 2 cut(s) 64, 149
BspPI GGATC 1 cut(s) 268
BsrDI GCAATG 1 cut(s) 384
BsrGI TGTACA 1 cut(s) 168
BssMI GATC 1 cut(s) 260
Bst2UI CCWGG 3 cut(s) 66, 239, 282
Bst4CI ACNGT 1 cut(s) 17
BstAUI TGTACA 1 cut(s) 168
BstC8I GCNNGC 1 cut(s) 244
BstDEI CTNAG 2 cut(s) 72, 136
BstKTI GATC 1 cut(s) 263
BstMAI GTCTC 1 cut(s) 375
BstMBI GATC 1 cut(s) 260
BstMWI GCNNNNNNNGC 2 cut(s) 243, 345
BstNI CCWGG 3 cut(s) 66, 239, 282
BstSCI CCNGG 3 cut(s) 64, 237, 280
BstSFI CTRYAG 1 cut(s) 343
BstX2I RGATCY 1 cut(s) 260
BstYI RGATCY 1 cut(s) 260
BsuRI GGCC 1 cut(s) 6
BtsI GCAGTG 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 244
CaiI CAGNNNCTG 1 cut(s) 71
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 169
CviJI RGCY 6 cut(s) 6, 54, 246, 269, 329, 348
CviKI_1 RGCY 6 cut(s) 6, 54, 246, 269, 329, 348
CviQI GTAC 1 cut(s) 169
DdeI CTNAG 2 cut(s) 72, 136
DpnI GATC 1 cut(s) 262
DpnII GATC 1 cut(s) 260
EcoRII CCWGG 3 cut(s) 64, 237, 280
FaiI YATR 4 cut(s) 92, 128, 162, 394
GsuI CTGGAG 1 cut(s) 249
HaeIII GGCC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 244
HinfI GANTC 2 cut(s) 198, 215
HphI GGTGA 1 cut(s) 99
Hpy166II GTNNAC 2 cut(s) 13, 169
Hpy188I TCNGA 1 cut(s) 301
Hpy8I GTNNAC 2 cut(s) 13, 169
HpyAV CCTTC 1 cut(s) 49
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 4 cut(s) 90, 119, 209, 339
HpyF10VI GCNNNNNNNGC 2 cut(s) 243, 345
HpyF3I CTNAG 2 cut(s) 72, 136
Kzo9I GATC 1 cut(s) 260
LmnI GCTCC 1 cut(s) 32
LpnPI CCDG 9 cut(s) 51, 78, 142, 224, 247, 251, 267, 279, 294
LweI GCATC 1 cut(s) 348
MaeIII GTNAC 3 cut(s) 17, 105, 284
MalI GATC 1 cut(s) 262
MboI GATC 1 cut(s) 260
MboII GAAGA 2 cut(s) 222, 224
MflI RGATCY 1 cut(s) 260
MluCI AATT 4 cut(s) 114, 361, 408, 412
MmeI TCCRAC 2 cut(s) 54, 156
MnlI CCTC 2 cut(s) 67, 187
MseI TTAA 3 cut(s) 78, 248, 411
MspR9I CCNGG 3 cut(s) 66, 239, 282
MvaI CCWGG 3 cut(s) 66, 239, 282
MwoI GCNNNNNNNGC 2 cut(s) 243, 345
NdeII GATC 1 cut(s) 260
NmuCI GTSAC 2 cut(s) 17, 105
PfeI GAWTC 2 cut(s) 198, 215
PshBI ATTAAT 1 cut(s) 411
Psp6I CCWGG 3 cut(s) 64, 237, 280
PspGI CCWGG 3 cut(s) 64, 237, 280
PspPI GGNCC 1 cut(s) 4
PstNI CAGNNNCTG 1 cut(s) 71
PsuI RGATCY 1 cut(s) 260
RsaI GTAC 1 cut(s) 170
RsaNI GTAC 1 cut(s) 169
SaqAI TTAA 3 cut(s) 78, 248, 411
Sau3AI GATC 1 cut(s) 260
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 3 cut(s) 66, 239, 282
SetI ASST 8 cut(s) 41, 56, 70, 78, 161, 248, 271, 331
SfaNI GCATC 1 cut(s) 348
SfcI CTRYAG 1 cut(s) 343
Sse9I AATT 4 cut(s) 114, 361, 408, 412
SsiI CCGC 1 cut(s) 253
StyD4I CCNGG 3 cut(s) 64, 237, 280
TaaI ACNGT 1 cut(s) 17
TasI AATT 4 cut(s) 114, 361, 408, 412
TatI WGTACW 1 cut(s) 168
TfiI GAWTC 2 cut(s) 198, 215
Tru1I TTAA 3 cut(s) 78, 248, 411
Tru9I TTAA 3 cut(s) 78, 248, 411
TscAI CASTG 1 cut(s) 108
TseFI GTSAC 2 cut(s) 17, 105
Tsp45I GTSAC 2 cut(s) 17, 105
TspDTI ATGAA 2 cut(s) 49, 318
TspRI CASTG 1 cut(s) 108
VspI ATTAAT 1 cut(s) 411
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.